Содержание

Средства, влияющие на обмен липидов

{{/if}} {{each list}} ${this} {{if isGorzdrav}}

Удалить

{{/if}} {{/each}} {{/if}}

Заказать препараты для улучшения липидного обмена

Сайт “36.6” дает возможность оформить заказ лекарственного средства с последующей доставкой в одну из 1200 точек по Москве и Санкт-Петербургу, а также в Московской и Ленобласти. Оплата производится при получении лекарства непосредственно в аптеке. Удобная система поиска позволяет найти препараты для улучшения липидного обмена как по бренду, так и по действующему веществу. Таким образом можно подобрать как более дорогие, так и более дешевые аналоги.

Также на цену влияют постоянные скидки и акции, что делает покупку выгодной. Все товары прошли обязательную сертификацию.

Показания

Препараты для липидного обмена относятся к группе статинов [1]. Иными словами, лекарственное средство применяется при избыточном весе, а также для восстановления естественных процессов в организме. Оно снижает уровень холестерина, повышает метаболизм и улучшает энергетический баланс. Также их применяют при жировом поражении печени и других органов. Практика показывают, что такие лекарственные средства могут быть назначены и при более серьезных заболеваниях: гепатит, атеросклероз и другие.

Основными показаниями к применению являются:

  • избыточный вес;
  • профилактика ожирения;
  • нарушение менструального цикла;
  • лечение целлюлита;
  • предрасположенность к отекам и запорам;
  • аллергический дерматит;
  • острый гепатит;
  • ишемический инсульт;
  • атеросклероз.

Противопоказания

Как и любые другие препараты, связанные с изменением естественных процессов в организме, средства, влияющие на обмен липидов, имеют ряд противопоказаний:

  • беременность;
  • период лактации;
  • индивидуальная непереносимость отдельных компонентов;
  • нарушение функции печени и почек;
  • органические поражения сердца.

Формы выпуска

Форма выпуска препаратов для нормализации липидного обмена зависит от скорости доставки действующего вещества в организм, а также механизмов назначаемого лечения. Например, в отличие от таблеток, порошок быстрее всасывается в кровь. Прежде чем приобретать медикаменты, необходимо проконсультироваться со специалистом.

Разделяют следующие формы выпуска этих лекарственных средств:

  • таблетки;
  • капсулы;
  • гранулы;
  • порошки;
  • драже.

Страны изготовители

Препараты для нормализации липидного обмена изготавливаются по всему миру.

На сегодняшний день особенно выделяются:

  • российские;
  • американские;
  • французские;
  • индийские и другие.

ПЕРЕД ПРИМЕНЕНИЕМ ПРЕПАРАТОВ НЕОБХОДИМО ОЗНАКОМИТЬСЯ С ИНСТРУКЦИЕЙ ПО ПРИМЕНЕНИЮ ИЛИ ПРОКОНСУЛЬТИРОВАТЬСЯ СО СПЕЦИАЛИСТОМ.

Список литературы:

  1. [i] Черкасова Л. С., Мережинский М. Ф., Обмен жиров и липидов, Минск, 1961;

Коррекция липидного обмена методами экстракорпоральной гемокоррекции.

Москва

В Клиническом госпитале на Яузе опытные доктора вовремя выявят и назначат эффективное лечение нарушений липидного обмена (гиперхолестеринемии, гипертриглицеридемии). Комплексное лечение дислипидемий в нашей клинике включает правильное питание, адекватный двигательный режим, медикаментозную терапию и инновационный метод лечения — экстракорпоральную гемокоррекцию (ЭГ), восстанавливающую баланс липопротеидов. Курс ЭГ уменьшает размер атеросклеротических бляшек, снижает риск развития осложнений (инфаркта, инсульта, гангрены), усиливает действие лекарств, корректирующих повышенный уровень холестерина в крови, и позволяет уменьшить их дозировку.

Согласно статистическим данным, нарушения липидного обмена определяют у 10-20% детей и 40-60% взрослого населения. Нарушение соотношения липопротеинов (ЛП) высокой и низкой (очень низкой) плотности и триглицеридов способствуют развитию атеросклероза. Чтобы восстановить пропорцию липопротеидов, макрофаги (клетки-«мусорщики» нашего организма) поглощают ЛПНП и оседают во внутренней оболочке сосудов (интиме), провоцируя развитие атеросклероза и образование атеросклеротических бляшек.

  • Пол (мужской)
  •  Возраст (старше 40 лет)
  • Питание с преобладанием животных жиров
  • Вредные привычки (курение, алкоголь)
  • Малоподвижный образ жизни
  • Стрессы
  • Наследственность
  • Беременность
  • Нарушения белкового и углеводного обмена (сахарный диабет, болезнь Кушинга)
  • Нарушения всасывания и переработки жиров при патологии желудочно-кишечного тракта

В зависимости от преимущественной локализации атеросклероза и вызванных им нарушений кровообращения человека могут беспокоить:

  • Боли в области сердца в покое и при выполнении физических действий (стенокардия при ишемической болезни сердца — ИБС).
  • Головокружение, беспричинный шум в ушах, снижение памяти и способности к концентрации внимания (признаки цереброваскулярной болезни — ЦВБ).
  • Повышение артериального давления.
  • Появление ксантом и ксантелазм (очагов жировых отложений в коже, в том числе в области внутреннего угла глаза).
  • Боли в ногах в области икроножных мышц при ходьбе (симптомы облитерирующего атеросклероза сосудов нижних конечностей).

Диагностика и терапия дислипидемий

В Клиническом госпитале на Яузе диагностика нарушений липидного обмена проводится с помощью биохимического анализа крови, который определяет уровни ЛПНП, ЛПВП, триглицеридов и холестерина, определения коэффициента атерогенности (соотношения липопротеидов высокой и низкой плотности). При наличии показаний выполняется триплексное сканирование сосудов, магнитно-резонансная или компьютерная ангиография, выявляющие участки кровеносного русла с нарушенной проходимостью.

Результаты исследований изучаются врачом (кардиологом, неврологом, сосудистым хирургом) который после осмотра пациента и беседы с ним назначает индивидуальную коррекцию диагностированных изменений. Лечение дислипидемии подразумевает не только назначение гиполипидемических препаратов и симптоматической терапии, но и диету с ограничением животных жиров, подбор адекватной физической нагрузки.

Также для лечения данной патологии в Клиническом госпитале на Яузе успешно применяется экстракорпоральная гемокоррекция (ЭГ, синоним — гравитационная хирургия крови, ГХК).

Лечение гиперхолестеринемии методами экстакорпоральной гемокоррекции

Нормализация баланса ЛПВП и ЛПНП, а также восстановление нормального уровня холестерина и триглицеридов достигается использованием методов криоафереза (H.E.L.P.-афереза), иммуносорбции и каскадной фильтрации плазмы крови. Данные методики позволяют достичь следующих эффектов:

  • Нормализовать уровень холестерина в крови, уменьшить объём холестериновых отложений в стенках сосудов, снизить вязкость крови и склонность ее к тромбообразованию;
  • Улучшить кровоснабжение миокарда, сделать более редкими приступы стенокардии, увеличить устойчивость к физическим нагрузкам, снизить риск развития инфаркта миокарда
  • Улучшить функции нервной системы — память, внимание, настроение, сон, уменьшить головокружение, шум в голове, снизить риск развития инсульта
  • Активизировать кровообращение в нижних конечностях, способствуя заживлению трофических язв, уменьшить риск развития гангрены нижней конечности
  • Увеличить чувствительность клеток организма к лекарственным средствам;
  • Улучшить работу внутренних органов за счет активизации их кровоснабжения
  • Оказать общее омолаживающее воздействие за счёт стимулирования процессов регенерации в коже на фоне улучшения кровообращения

Показания к назначению ЭГ при дислипидемии

  • Гомозиготная и гетерозиготная семейная гиперхолестеринемия
  • Недостаточная эффективность холестеринснижающих препаратов
  • Повышение уровня липопротеида (а)
  • Высокий уровень общего холестерина
  • Повышение коэффициента атерогенности > 3 (увеличение объема ЛПНП и уменьшение объема ЛПВП)
  • Артериальная гипертензия
  • Наличие в анамнезе патологий, спровоцированных атеросклерозом (ИБС, ЦВБ, облитерирующий атеросклероз, состояние после инфаркта миокарда, церебрального инсульта, операций на сосудах сердца)
  • Противопоказания к назначению холестеринснижающих препаратов или необходимость снижения их доз в результате развития осложнений от их приема

Если вы хотите затормозить или остановить развитие атеросклероза, уменьшить его клинические проявления, добиться омолаживающего эффекта за счёт активизации кровоснабжения и улучшения функционирования всех внутренних органов и систем, запишитесь на прием к кардиологу Клинического госпиталя на Яузе.

Наши специалисты тщательно вас обследуют, поставят верный диагноз и при необходимости назначат адекватную терапию.

Цены на услуги Вы можете посмотреть в прайсе или уточнить по телефону, указанному на сайте.

Для нормализации липидного обмена — Аптека 9-1-1

Обменные процессы в организме человека

Обмен веществ в организме человека по своей сути представляет набор химических реакций, которые способствуют правильному усвоению получаемых с питанием микроэлементов и нормальному функционированию всех органов и систем тела. Нарушения метаболизма приводят к неблагоприятным результатам:

  • снижению иммунитета;
  • ухудшению работоспособности;
  • повышению риска заболеваний;
  • увеличению избыточного веса.

Причинами данных осложнений могут быть следующие особенности образа жизни и вредные привычки:

  • употребление нездоровой пищи;
  • нерегулярное и несбалансированное питание;
  • переедание;
  • недостаток сна и отдыха;
  • малоподвижность;
  • недостаток кислорода;
  • проблемы гормонального характера.

Все это приводит к ухудшению качества жизни и здоровья человека, преждевременному старению и нарушению функционирования органов и систем в результате недостаточного поступления полезных веществ.

Вспомогательные пищевые добавки

Чтобы восстановить нарушенные процессы обмена веществ в организме необходимо восполнить недостающие элементы с помощью натуральных пищевых добавок. Это в значительной степени улучшит функционирование сердечно-сосудистой, нервной, пищеварительной систем и окажет общетонизирующее действие на организм в целом.

К наиболее активным и действенным веществам, входящим в состав соответствующих БАДов, можно отнести рыбий жир. Его значение для работы организма трудно переоценить, благодаря комплексному влиянию на все системы и органы:

  • улучшение состояния кожи;
  • укрепление костей;
  • улучшение памяти;
  • концентрация внимания;
  • повышение иммунитета;
  • нормализация кровообращения;
  • общее укрепление организма.

Сориентироваться в многообразии препаратов для нормализации обмена веществ вам помогут специалисты «Аптеки 9-1-1».

Жить или не жить? Выбор определяет… липидный обмен // Ваше здоровье

Что является составляющими липидного обмена?

— Метаболизм веществ в организме определяется обменом углеводов, белков и липидов. Составляющими жирового обмена являются расщепление, переваривание и всасывание липидов в пищеварительном тракте, обмен триацилглицеролов (сложные липиды, запасаемые в жировом депо), фосфолипидов (компонентов клеточных мембран) и холестерола («полезного» холестерина), взаимопревращение жирных кислот и кетоновых тел, липогенез (процесс синтеза жирных кислот), катаболизм (процесс метаболического распада) липидов и жирных кислот.

Каким образом взаимосвязаны все обменные процессы? Расскажите о важности липидного обмена в метаболизме организма.

— В процессе эволюции живых организмов сначала сформировался углеводный обмен, основа которого строится на усвоении глюкозы – основного источника энергии. Органоиды клетки, обеспечивающие клеточное дыхание, — митохондрии — не могут без глюкозы. При избытке углеводов в организме обмен жиров замедляется, работа происходит в направлении синтеза новых жиров и отложении их про запас. Тесно переплетается с углеводным белковый обмен. Все аминокислоты синтезируются из метаболитов глюкозы, к ним присоединяются аминогруппы. Белок является основным поставщиком азота, при длительном голодании белок выполнять роль энергетического субстрата.

Жир в нашем организме делится на ненасыщенный и насыщенный, состоящий из глицерина и насыщенных жирных кислот. Источником насыщенных жиров являются продукты животного происхождения. Ненасыщенные жиры содержатся в растительных маслах, орехах, морской рыбе. В отличие от насыщенных жиров, ненасыщенные  синтезируются человеческим организмом в малом количестве. Большинство жиров, которые человек потребляет с пищей, используется в процессе жизнедеятельности или откладывается про запас. В норме только 5% жиров выводится из организма с помощью сальных и потовых желез.

При голодании организм сначала начинает тратить запасы глюкозы, которые откладываются в виде гликогена в печени и в мышцах. Запасов глюкозы хватает на два дня, затем начинают тратиться жирные кислоты, которые поддерживают весь организм, дают воду, тепло. Когда иссякают и жирные кислоты, организм начинает расходовать собственный белок, восстановить который уже нереально.

Невозможно недооценить значение липидного обмена для организма. Сердечная мышца для своей нормальной жизнедеятельности расходует жирные кислоты. У людей с нарушением липидного обмена возникает кардиопатология. Сердце гонит кровь по сосудам. Составляющая крови — вода — образуется от сжигания жиров. Как для мозга нужна глюкоза, так для сердечной мышцы необходимы жиры, мышечная ткань может использовать и то, и другое. Мышцы работают параллельно с мозгом и жировой тканью. Жировой обмен нарушается при недостаточной мышечной нагрузке, возрастает жировая ткань. Липидный обмен нужен для поддержания стационарности уровня глюкозы в крови. В этом случае, в первую очередь, страдает мозг. Он работает в узком диапазоне концентрации глюкозы. Увеличение уровня глюкозы вызывает гипергликемию, ее уменьшение — гипогликемию, в обеих ситуациях последствием является кома. Эволюционно мозг научился приспосабливаться к гипогликемии, задействовав запасы глюкозы из печени. Еще раз подчеркиваю, липидный обмен регулирует все процессы человеческого организма.

Расскажите, пожалуйста, о значении липидов для нашего организма.

— Жиры участвуют в формировании клеточной мембраны и соединительной ткани, повышают эластичность и проницаемость стенок кровеносных сосудов. Они также являются опорой для внутренних органов (сердце, печень, почки и др.). Ненасыщенные жиры и кислоты способствуют выведению из организма излишков холестерина. Липиды являются основным составляющим жирорастворимых витаминов А, Д, Е. Недостаток жиров негативно сказывается на состоянии кожи. Огромную роль жиры играют в синтезе гормонов.

Какие факторы влияют на интенсивность липидного обмена? Существуют ли различия по половому признаку в скорости осуществления липидного обмена?

— Регуляция жирового обмена происходит при участии ЦНС. Сильные эмоции отрицательно влияют на обмен жиров. Стресс усиливает липолиз, таким образом, высвобождаются жирные кислоты и глицерин, повышается уровень триглицеридов — главных источников энергии для клеток. Вредные привычки, такие как курение, уменьшают полезность альфа–холестерина. Если у человека курящего хотя бы незначительное повышение холестерина, то у него в 9 раз выше риск развития атеросклероза, ишемической болезни сердца, чем у некурящего с нормальным уровнем холестерина. При отказе от курения этот показатель нормализуется в течение года. Положительно влияет на липидный обмен употребление рыбьего жира, который уменьшает расщепление триглицеридов. Их количество меняется с возрастом. Максимальное количество триглицеридов у мужчин отмечено в 45–50 лет, у женщин — в 55–70 лет. Отмечено, что более интенсивно липидный обмен осуществляется у женщин до менопаузы, чему способствует выработка женских половых гормонов. Отсюда, женщины до менопаузы легче справляются с последствиями ожирения, чем после нее, когда риск развития ишемической болезни сердца, атеросклероза возрастает в несколько раз! Установлено, что на интенсивность липидного обмена влияет использование оральных противозачаточных средств, которые повышают содержание триглицеридов, холестерина и одновременно уменьшают концентрацию альфа–холестерина, входящего в состав липопротеинов высокой плотности.

Имеет ли значение индекс массы тела (ИМТ) в качестве показателя оценки липидного обмена?

— Индекс массы тела — идеальный вес, рассчитываемый для каждого конкретного человека, позволяющий определить плотность тела. Последние исследования расширили диапазон, соответствующий показателям здорового человека. Так, нормой является ИМТ от 25 до 35. Опасение вызывает ИМТ менее 25, а человек с ИМТ более 35 считается больным, его жизни явно угрожает опасность. Шансов умереть от сердечной патологии у людей с ИМТ, не входящим в этот диапазон, в 3 раза выше, чем у людей с нормальными показателями.

Поддерживая здоровье, необходимо держать под контролем соотношение костной, мышечной и жировой ткани в организме. Избытка в организме подкожной жировой ткани стоит опасаться мужчинам, для которых ее не должно быть в норме. Образование подкожной жировой ткани у мужчин и ее отложение в области живота свидетельствует о гормональном сбое. У таких представителей сильного пола не активирован тестостерон, способствующий производству белка в мышцах. По своей природе мужчины должны быть более активны, поэтому в норме у них должно быть преобладание мышечной и костной тканей над жировой. Источник энергии — глюкоза — у мужчин уходит в мышцы, а не про запас, как у женщин. У слабой половины человечества в норме увеличение каждые 9 лет объема талии на 4 см. На талии откладывается подкожный жир, который защищает тыл женщины.

Какие продукты следует исключить для того, чтобы липидный обмен стал более рациональным?

— Если у человека нет в анамнезе хронических заболеваний, употреблять в пищу можно все, но в меру. В любом возрасте нельзя переедать. Именно тогда соотношение между процессами расщепления питательных веществ и их накапливанием, нарушаются.

Проще сказать, какие продукты необходимы для рационального осуществления липидного обмена. Полезны апельсины, бобовые, мясо морской рыбы, чеснок, соя, яблоки, миндаль, огурцы и цветная капуста, т.е. та пища, где в большом количестве содержатся не синтезируемые нашим организмом витамины группы В, сера, селен, рыбий жир, незаменимые аминокислоты цистеин и метионин. Потребность в сберегающих микро– и макроэлементах: фосфоре, кальции, калии, натрии, цинке, меди, железе, магнии значительно меньше за счет их накопления в организме.

Существует ли угроза современным детям нарушением в липидном обмене, с чем это связано?

— Сбой в обменных процессах опасен в любом возрасте, особенно у детей и людей пожилого возраста, т.к. отрегулировать метаболизм у растущего и стареющего организма крайне трудно. Некоторые современные дети склонны к ожирению из–за малой физической активности, переедания, эндокринных нарушений. К сожалению, они уже рождаются с нарушенным метаболизмом. Возможно, причина тому — неправильное питание матери в период беременности. Не исключено, что нарушения в липидном обмене у детей связаны с растущим количеством предрасположенных к аллергии женщин, что свидетельствует о том, что обмен жиров и иммунный ответ организма тесно взаимосвязаны.

Возможно ли полностью отказаться от продуктов, содержащих жиры, и худеть без усилий?

— Все органические вещества, используемые человеком для поддержания жизнедеятельности, должны быть сбалансированы. Вегетарианцы пытаются обходиться без белков животного происхождения, но в них содержится сера — жизненно важный макроэлемент — основа белка. Как нельзя полностью отказаться от белков, из которых строятся наши клетки, так невозможно полностью лишить себя липидов, они не синтезируются в человеческом организме, но необходимы для поддержания его нормальной жизнедеятельности.

Препарат, регулирующий липидный и углеводный обмен

Липоевая кислота

Капс. 300 мг: 30, 50 или 60 шт.

рег. №: ЛП-005001 от 22.08.18
Нейролипон

Капс. 300 мг: 30 или 60 шт.

рег. №: ЛП-001279 от 25.11.11
Политион®

Концентрат для приготовления раствора для инфузий

рег. №: ЛП-003539 от 29.03.16
Тиоктовая кислота

Концентрат д/пригот. р-ра д/инф. 30 мг/мл: 10 мл амп. 5 или 10 шт.

рег. №: ЛП-003918 от 21.10.16
Произведено: ОЗОН (Россия)
Тиоктовая кислота

Концентрат д/пригот. р-ра д/инф. 30 мг/мл: 10 мл или 20 мл 10 шт.

рег. №: ЛП-006129 от 05.03.20
Тиоктовая кислота

Таб., покр. пленочной оболочкой, 300 мг: 10, 20, 30, 40, 50, 60, 80, 90, 100, 120, 150, 200 или 300 шт.

рег. №: ЛП-002355 от 31.01.14
Произведено: ОЗОН (Россия)
Тиоктовая кислота

Таб. , покр. пленочной оболочкой, 600 мг: 10, 20, 30, 40, 50, 60, 80, 90, 100, 120, 150, 200 или 300 шт.

рег. №: ЛП-002355 от 31.01.14
Произведено: ОЗОН (Россия)
Тиоктовая кислота-Виал

Таб. , покр. пленочной оболочкой, 300 мг: 10, 20, 30, 40, 50, 60, 70, 80, 90 или 100 шт.

рег. №: ЛП-004094 от 23.01.17
Тиоктовая кислота-Виал

Таб., покр. пленочной оболочкой, 600 мг: 10, 20, 30, 40, 50, 60, 70, 80, 90 или 100 шт.

рег. №: ЛП-004094 от 23.01.17
Тиолепта®

Концентрат д/пригот. р-ра д/инф. 30 мг/мл: 10 мл амп. 10 шт.

рег. №: ЛП-004656 от 25.01.18
Тиолепта®

Р-р д/инф. 12 мг/мл: 50 мл фл. 1 или 10 шт.

рег. №: ЛСР-009029/10 от 31.08.10
Тиолепта®

Таб. , покр. оболочкой, 300 мг: 10, 30, 60 или 90 шт.

рег. №: ЛС-002172 от 24.05.13
Тиолепта®

Таб., покр. пленочной обол., 600 мг: 30 или 60 шт.

рег. №: ЛСР-009442/09 от 24.05.13
Тиолипон

Таб. , покр. пленочной оболочкой, 300 мг: 20, 30, 40 или 50 шт.

рег. №: ЛП-001209 от 15.11.11
Тиолипон

Таб., покр. пленочной оболочкой, 600 мг: 20, 30, 40 или 50 шт.

рег. №: ЛП-001209 от 15.11.11
Эслидин®

Капсулы

рег. №: ЛСР-001048/08 от 26.02.08 Дата перерегистрации: 28.09.17
Эспа-Липон

Таб., покр. пленочной оболочкой, 600 мг: 30, 60 или 100 шт.

рег. №: П N012834/01 от 14.02.11
Эспа-Липон

Таб. , покр. пленочной оболочкой, 600 мг: 30, 60 или 100 шт.

рег. №: П N012834/01 от 14.02.11

Липидный профиль, базовый. Узнать стоимость в лаборатории KDL.

Липидный профиль – комплекс тестов, который включает в себя анализ на общий холестерин, ЛПВП (липопротеины высокой плотности), ЛПНП (липопротеины низкой плотности), ЛПОНП (липопротеины очень низкой плотности) и триглицериды. Знать свой липидный профиль необходимо каждому, кто заботится о здоровье своей сердечно-сосудистой системы и хочет снизить риск развития атеросклероза и заболеваний сердца, а также тем, кто проходит лечение. Контроль липидного профиля важен и при смене образа жизни, питания, физической нагрузки, при приеме лекарственных средств.

Показатели липидного профиля:

Общий холестерин – общий уровень холестерина в крови. Это вещество входит в состав мембран клеток и необходимо для функционирования всех систем организма, однако его избыток связывают с развитием атеросклероза и сердечно-сосудистых патологий.

ЛПВП – липопротеины высокой плотности. Их еще называют «хорошим холестерином». Высокий уровень ЛПВП снижает риск развития атеросклероза и сердечно-сосудистых заболеваний. ЛПВП помогают выводить часть холестерина из крови, возвращая его в печень. Следует стремиться к тому, чтобы уровень ЛПВП был как можно выше. Особенно это важно для пациентов, страдающих сердечно-сосудистыми заболеваниями.

ЛПНП и ЛПОНП – липопротеины низкой и очень низкой плотности. Именно этот тип холестерина считается «вредным» из-за доказанной связи между высоким содержанием ЛПНП и развитием сердечно-сосудистых заболеваний. Главная цель при лечении в случае нарушений липидного обмена состоит именно в снижении уровня ЛПНП и ЛПОНП.

Триглицериды — частицы жира, уровень содержания которых в крови повышается при таких состояниях, как неконтролируемый диабет и ожирение. Злоупотребление алкоголем и прием некоторых лекарственных препаратов также способны повысить уровень триглицеридов. Высокие уровни триглицеридов означают более высокий риск развития сердечно-сосудистых заболеваний.

В каких случаях обычно назначают исследование?

  • При профилактическом обследовании здоровых людей
  • При повышении уровня общего холестерина.
  • При наличии у ближайших родственников следующих состояний: сахарный диабет, инсульт, инфаркт миокарда, артериальная гипертензия.
  • При наличии других факторов риска развития атеросклероза и сердечно-сосудистых заболеваний (возраст более 45 лет для мужчин и 55 лет для женщин, курение, избыточный вес, нарушения углеводного обмена, повышенное артериальное давление).
  • При контроле эффективности гиполипидемической диеты и/или медикаментозного лечения статинами.

Что именно определяется в процессе анализа?

Проводится измерение концентрации различных показателей липидного профиля (общий холестерин, ЛПНП, ЛПОНП, ЛПВП, триглицериды) колориметрическим фотометрическим методом.  

Что означают результаты теста?

При выдаче результата анализа на бланке будет указано полученное значение, а также границы, к которым надо стремиться. Врачи при ведении пациентов с рисками сердечно- сосудистых осложнений в первую очередь руководствуются не референсными значениями, а порогом принятия решений — целевыми значениями показателей липидного профиля, которые рассчитаны в соответствии с популяционными и клиническими критериями, подкреплены многочисленными статистическими данными и утверждены ВОЗ.

Для общего холестерина оптимальное значение должно быть ниже 5,2 ммоль/л. Это усредненная верхняя граница, к которой надо стремиться. Значения в диапазоне 5,2–6,1 ммоль/л считаются пограничными. При значениях выше 6,1 ммоль/л можно говорить о серьезных рисках развития атеросклероза.

Для ЛПНП оптимальное значение составляет не более 2,6 ммоль/л. Пограничными считаются значения от 2,6 до 3,3 ммоль/л. Выше 3,3 ммоль/л — риск развития атеросклероза.

Значение уровня ЛПВП в норме должно быть не менее 1,03 ммоль/л для пациентов с низким риском развития атеросклероза. Для пациентов группы риска, а также для пациентов, уже страдающих атеросклерозом, целевой показатель выше — более 1,55 ммоль/л.

Для триглицеридов нормой считается значение до 1,7 ммоль/л. От 1,7 до 2,2 ммоль/л — пограничное значение, выше 2,2 ммоль/л — опасно повышенное, связанное с риском развития атеросклероза. Однако следует помнить, что само по себе повышение триглицеридов может и не быть признаком атеросклероза или нарушения липидного обмена. Так, это может быть связано с тем, что пациент неправильно подготовился к сдаче анализа (не выдержал 10–12-часового голодного перерыва) или иными патологическими процессами.

Сроки выполнения теста.

Результат можно получить через 1-2 дня после сдачи анализа.

Как подготовиться к анализу?

Для того, чтобы сдать анализ на липидный профиль, рекомендуется воздерживаться от еды в течение 10–12 часов непосредственно перед взятием крови. Также перед сдачей анализа врачи рекомендуют:

  • в течение трех недель соблюдать свой обычный режим и рацион питания
  • за 3 дня до сдачи анализа воздержаться от употребления алкоголя
  • непосредственно перед сдачей анализа воздержаться от курения
  • осуществлять физические нагрузки в обычном режиме
  • сообщить врачу о приеме лекарственных препаратов, т. к. некоторые препараты могут иметь влияние на липидный профиль.

что это такое, как применяются

 

Cостояние печени играет жизненно важную роль для здоровья человека. Этот орган весом более килограмма выполняет множество задач. В одной клетке печени, гепатоците, протекает около 500 различных биохимических процессов1. В печени осуществляется распад и/или детоксикация вредных веществ, а также выведение их из организма. Кроме того, орган синтезирует важнейшие составные части биологических мембран — фосфолипиды2.

Что такое клеточная мембрана?

 

Клетки — основные строительные блоки человеческого организма. Они, в свою очередь, не могут существовать без жиров и фосфолипидов, образующих наружную мембрану, «стенку» клетки, которая удерживает внутри нее цитоплазму. Мембрана представляет собой два слоя фосфолипидов, которые состоят из гидрофильной «головки», притягивающейся к воде, и гидрофобного, то есть водоустойчивого «хвоста». «Головки» двух рядов фосфолипидов обращены наружу, к жидкости, а «хвосты» скрепляются друг с другом, обеспечивая клеточным стенкам высокую прочность2.

Фосфолипиды выполняют структурную функцию, поддерживая клеточный каркас, участвуют в процессах молекулярного транспорта, ферментативных и других, не менее значимых процессах. Любое нарушение их деятельности может иметь самые серьезные последствия2.

Гепатоциты — «кирпичики» печени

Клетки печени, гепатоциты, составляют до 70-85% массы органа. Они несут основную ответственность за деятельность печени, участвуя в таких процессах, как:

  • Синтез и хранение протеинов
  • Расщепление углеводов
  • Синтез холестерина, желчных солей и фосфолипидов
  • Детоксикация, расщепление и выведение веществ
  • Инициирование образования и, собственно, выработка желчи.

Клеточная стенка гепатоцитов, как и любых других клеток, состоит из фосфолипидов, обеспечивающих ее полноценное функционирование. Однако, к сожалению, она уязвима. Воздействие негативных факторов, например, некоторых лекарственных препаратов, токсичных веществ и особенно алкоголя и даже несбалансированного рациона приводит к нарушению внутриклеточного обмена и гибели гепатоцитов. Так развиваются различные заболевания печени1.

 

Когда печень «шалит»?

Проблемы с печенью прежде всего связаны с хронической интоксикацией, которая, в свою очередь, может быть вызвана различными заболеваниями и состояниями. К ним относится хронический прием алкоголя, сахарный диабет 2 типа, экологическая интоксикация, «химизация» пищи и быта, неблагоприятное действие лекарств и другие факторы. Все они способствуют развитию оксидативного стресса вследствие нарушения адекватной работы антиоксидантных механизмов. Постепенно на фоне хронического негативного влияния происходит деструкция клеточных мембран, белков и ДНК, нарушается работа клетки.

Итогом длительной интоксикации является триада: перекисное окисление липидов (окислительная их деградация, происходящая под действием свободных радикалов), накопление в клетках печени жира более 5% от массы органа (стеатоз) и хроническое воспаление1.

Эссенциальный — значит, необходимый

Для лечения поражений печени различного происхождения широко применяются эссенциальные фосфолипиды (ЭФЛ). Их принципиальным отличием от обычных фосфолипидов является наличие дополнительной молекулы линолевой кислоты. Это позволяет ЭФЛ с легкостью восполнять дефекты клеточной мембраны, что увеличивает ее гибкость и нормализует функции. Именно наличие линолевой кислоты считается наиболее важным отличием ЭФЛ от классических фосфолипидов, например, лецитина, которое лежит в основе лечебных преимуществ эссенциальных фосфолипидов2.

В каком-то смысле назначение ЭФЛ можно назвать мембранной терапией, ведь их активность связана именно с клеточными стенками. Возможным же такое лечение стало благодаря соевым бобам, из которых и получают ценное вещество3.

Соевые бобы: из глубины веков до наших дней

Однолетнее растение семейства Бобовые на протяжении тысячелетий используется человеком. Упоминания о нем есть в книгах времен императора Шэн Нунг, царствовавшего в 2838 году до нашей эры 1. Тогда соевые бобы считались одни из пяти «святых зерновых», без которых была невозможна жизнь на земле.

Сегодня известно около 800 видов соевых бобов. Они содержат 35-40% белков, 20-30% углеводов, 5-10% сопутствующих веществ (витамины, тритерпеновые сапонины, флавоноиды и т.д.), а также 12-18% жиров. Масла, входящие в состав бобов, на 90-95% состоят из глицеридов жирных кислоты, в частности, олеиновой и линолевой. В процессе переработки сырого масла удается получить 30-45% соевого лецитина (фосфатидилхолина), который и является «целевым продуктом», используемым в фармацевтической промышленности для создания препаратов, проявляющих гепатопротекторный эффект.

Фосфатидилхолины в действии

Получаемые из соевых бобов фосфатидилхолины представляют собой типичный липидный двойной слой, состоящий из гидрофильной «головки» и гидрофобного «хвоста» и являющийся основным структурным компонентом биологических мембран. Эссенциальные фосфолипиды легко заменяют эндогенные, то есть, «собственные» фосфолипиды организма, которые оказались по тем или иным причинам повреждены, встраиваясь в клеточную мембрану. При этом ЭФЛ могут поступать в организм как перорально, в виде твердых лекарственных форм (капсулы), так и внутривенно, с инъекционным раствором высокой степени очистки4.

Кстати, название «эссенциальные фосфолипиды» зарегистрировано только для препаратов, где содержится не менее 75% фосфатилхолина. Примеромлекарственного средства, содержащего ЭФЛ в высокой концентрации — Эссенциале Форте Н. В 1 капсуле Эссенциале форте Н содержится 76% фосфатидилхолина3.

На защиту мембран!

Встраивание эссенциальных фосфолипидов в поврежденные мембраны гепатоцитов обеспечивает восстановление нормальных мембранных структур, что, в свою очередь приводит к комплексному терапевтическому эффекту. Какое же действие оказывают ЭФЛ? Прежде всего, они проявляют протективные (защитные) и регенеративные свойства в отношении клеток печени1. При этом поражение печени может быть вызвано самыми различными факторами, среди которых токсические, воспалительные, аллергические, обменные и иммунологические реакции1.

Доказано, что ЭФЛ защищают гепатоциты при повреждениях, связанных с действием различных химических веществ, алкоголя, наркотических препаратов, цитостатиков, которые применяются для лечения онкологических заболеваний, ионизирующего излучения и так далее1.

ЭФЛ и полиненасыщенные жирные кислоты

Механизм действия ЭФЛ сродни действию омега 3-6-полиненасыщенных жирных кислот (ПНЖК), поскольку первые представляют собой по сути природную форму существования вторых. Омега 3-6-ПНЖК — эссенциальные жиры, снижающие риск ряда заболеваний, в том числе сердечно-сосудистых и диабета. Они не синтезируются в организме, и должны ежедневно поступать в организм в количестве 2 г омега-3 и 6 граммов омега-6 ПНЖК. Однако красные сорта рыбы, грецкие орехи, растительные масла, соевые бобы, где содержатся в большом количестве эти кислоты, высококалорийны, что ограничивает их употребление5.

Препараты, содержащие ЭФЛ, например, Эссенциале форте Н, могут широко применяться для восполнения диетического дефицита полиненасыщенных жирных кислот, не увеличивая калорийность рациона6. А какую важную роль они играют при заболеваниях, связанных с нарушением обмена жиров!

Холестерин — стоп!

Эссенциальные фосфолипиды принимают участие в транспорте холестерина в плазме и тканях, а также образовании липопротеинов высокой и низкой плотности (ЛПВП и ЛПНП) 7. Напомним, что именно с повышением уровня ЛПНП и триглицеридов и снижением содержания ЛПВП связано одно из самых опасных заболеваний — атеросклероз.

ЭФЛ обеспечивают так называемую системную мобилизацию холестерина и его утилизацию на всех этапах метаболизма за счет ряда процессов, в том числе:

  • Повышение синтеза ЛПНП и мобилизация холестерина из плазмы крови
  • Обеспечение захвата ЛПНП гепатоцитами
  • Повышение секреции холестерина, фосфолипидов и жиров в желчь, что, соответственно, снижает их накопление в печени. 8

В состав желчи входят желчные кислоты (около 70%) и ЭФЛ (фосфатидилхолин, составляет 22% желчи)9. У здоровых людей ЭФЛ обеспечивают растворимость холестерина. Если же соотношение желчных кислот и ЭФЛ нарушается, кристаллы холестерина могут выпадать в осадок, вследствие чего развивается желчнокаменная болезнь (ЖКБ).

 

Камни в желчном пузыре: легче предотвратить, чем лечить

Как известно, до 90% желчных камней являются преимущественно холестериновыми, состоящими как минимум на 70% из холестерина10. Увеличение выброса в желчь холестерина, приводящее к камнеобразованию, может происходить вследствие несбалансированности рациона и его насыщения животными жирами. Важным фактором риска ЖКБ считается и экологическое загрязнение, приводящее к хронической интоксикации организма и, как следствие, увеличению потребности в антиоксидантах и ЭФЛ, необходимых для связывания токсических веществ. Если запасы ЭФЛ и антиоксидантов не пополняются, функция клеточных мембран нарушается, и организм начинает накапливать холестерин, чтобы сохранить структуру клеточной стенки, запуская процесс камнеобразования11, 12.

К группе повышенного риска ЖКБ относятся лица, злоупотребляющие алкоголем. Профилактическое назначение препаратов ЭФЛ тем, кто испытывает высокую нагрузку токсинами или алкоголем, компенсирует дефицит фосфолипидов и препятствует камнеобразованию12.

Неалкогольная жировая болезнь печени

Важный эффект ЭФЛ достигается благодаря их способности улучшать обмен липидов. Он особенно актуален при лечении неалкогольной жировой болезни печени (НАЖБП), которая возникает вследствие избыточного накопления жиров в органе. Необходимо отметить, что распространенность этого заболевания постоянно растет, в том числе и у детей и подростков, особенно живущих в городах6. В РФ только у пациентов общей практики распространенность НАЖБП достигает 27%6!

На фоне заболевания развивается комплекс патологических нарушений, среди которых снижение чувствительности тканей к инсулину, повышение содержания инсулина в крови. Увеличивается масса висцерального жира, что приводит к ожирению и артериальной гипертензии. У больных часто развивается сахарный диабет 2 типа и гиперлипидемия — повышение уровня холестерина и триглицеридов в крови. Люди, страдающие НАЖБП, должны контролировать калорийность рациона, минимизировать поступление транс-жиров, холестерина и увеличить потребление полиненасыщенных липидов (более 10 граммов в сутки)7. В связи с высокой калорийностью содержащих ПНЖК продуктов особое значение приобретают препараты ЭФЛ, оказывающие выраженный терапевтический эффект.

Фосфолипиды при НАЖБП

При жировой инфильтрации гепатоцитов, которая наблюдается у больных НАЖБП, препараты, содержащие эссенциальные фосфолипиды, способствуют13 снижению стресса митохондрий клеток, обусловленного избытком жирных кислот, уменьшению выраженности воспалительного процесса и нормализации жирового обмена за счет коррекции дислипидемии14. Назначение этих препаратов позволяет улучшить липидный состав крови, показатели перекисного окисления жиров и восстановить систему антиоксидантной защиты в целом6.

Клинически доказано, что эссенциальные фосфолипиды, например, в составе препарата Эссенциале форте Н, при НАЖБП улучшают течение и прогноз жировой инфильтрации печени, повышают чувствительность тканей к инсулину, нормализуют липидный профиль (то есть, способствуют снижению уровня «плохого» холестерина и триглицеридов) и к тому же уменьшают выраженность симптомов нарушений пищеварения.

Испытание алкоголем

Не менее важным показанием к назначению эссенциальных фосфолипидов является алкогольная болезнь печени (АБП). Высокому риску развития заболевания подвергаются люди, которые ежедневно принимают 40-80 мл чистого этанола на протяжении 4-6 лет15. Алкоголь богат «легкими» углеводными калориями, которые постепенно вызывают жировую дегенерацию внутренних органов. Кроме того, он способствует развитию нарушения кровообращения органа. При хронической алкогольной интоксикации на фоне оксидативного стресса происходит некроз гепатоцитов, развивается хронический воспалительный процесс и фиброз печени. Механизм развития последнего во многом обусловлен активацией так называемых звездчатых клеток. В норме они находятся в состоянии покоя, а при повреждении гепатоцитов «просыпаются» и становятся способными к интенсивному делению в участках воспаления16. В результате ткань печени разрастается, и в дальнейшем этот процесс часто заканчивается циррозом.

Действие ЭФЛ при алкогольном поражении печени

Назначение эссенциальных фосфолипидов при алкогольном поражении печени позволяет связать активные формы алкоголя, которые образуются при поступлении высоких доз алкоголя и «запускают» механизм оксидативного стресса. Благодаря высокой биодоступности и возможности внедряться в клеточные мембраны гепатоцитов ЭФЛ способствуют удалению свободных радикалов и восстанавливают структуру клеточной стенки. Кроме того, ЭФЛ оказывают антифибротическое действие, подавляя активацию звездчатых клеток печени и останавливая патологический процесс развития фиброза17.

ЭФЛ можно назвать универсальным средством, оказывающим противовоспалительное, антифибротическое действие, а также предотвращающим гибель клеток печени18. Эти возможности обеспечивают эффективность при хронических гепатитах, циррозе, жировой дистрофии печени, алкогольном гепатите и других нарушениях работы печени.

Масла семян улучшают липидный обмен и увеличивают антиоксидантный потенциал у крыс, которых кормили диетами, содержащими холестерин

Abstract

Целью этого исследования было найти наиболее ценное из четырех часто используемых масел семян для диет, предотвращающих атеросклероз. Были определены жирные кислоты, стерины, антиоксидантные соединения, стабильность и общий антиоксидантный потенциал улавливания радикалов (TRAP) в подсолнечном, подсолнечном высокоолеиновом, рапсовом и виноградном маслах. Самая высокая стабильность и самый высокий TRAP (3.8 Rancimat 120 ° C, часы и 324 нмоль / мл), а самая низкая стабильность и самый низкий TRAP (2,4 Rancimat 120 ° C, часы и 201 нмоль / мл) были у рапсового и подсолнечного масел соответственно. Влияние этих двух масел семян на липидный обмен и антиоксидантную активность было исследовано на 60 (разделенных на шесть диетических групп по 10) самцах крыс Wistar, адаптированных к безхолестериновой диете или к рациону с 1% холестерина. Контрольная группа (Control) придерживалась только основной диеты (BD). К BD добавляли 10 г / 100 г рапсового (группа Rapeseed) или подсолнечного (группа Sunflower) масла, 1 г / 100 г холестерина (группа Chol) или оба (группа Chol / Rapeseed) и (группа Chol / подсолнечник).Эксперимент длился 4 недели. В группе Chol / Rapeseed и Chol / Sunflower vs. Chol диета с добавлением масел значительно ( P <0,05) препятствовала повышению липидов плазмы из-за пищевого холестерина. Рапсовое и, в меньшей степени, подсолнечное масло увеличивали антиоксидантную активность плазмы у крыс, получавших BD без холестерина (увеличение TRAP: 20,8% и 16,0% и снижение MDA: 22,0% и 14,9% соответственно). У крыс, получавших диету Chol / Rapeseed и Chol / Sunflower vs. Chol, добавленные масла значительно препятствовали снижению антиоксидантной активности плазмы (TRAP: 21.7% и 16,3% и MDA: 26,2% и 21,5% соответственно). Следовательно, рапсовое и, в меньшей степени, подсолнечное масло обладают гиполипидемическими и антиоксидантными свойствами. Это становится более очевидным, когда эти масла добавляются в рацион крыс, получавших холестерин. В заключение, рапсовое масло обладает высокими органолептическими свойствами и высочайшей антиоксидантной способностью. Его влияние на уровень липидов в плазме и антиоксидантный потенциал значительно выше, чем у масел с относительно низкой антиоксидантной способностью. Вышеупомянутые свойства делают рапсовое масло предпочтительным выбором для диет, предотвращающих атеросклероз.

Ключевые слова

Масла из семян

Жирные кислоты

Стеролы

Антиоксиданты

Крысы

Липопротеины

Антиоксидантная способность

Рекомендуемые статьи Цитирующие статьи (0)

Science Посмотреть полный текст .

Рекомендуемые статьи

Ссылки на статьи

Frontiers | Улучшение метаболизма глюкозы и липидов в раннем возрасте женского потомства за счет материнского диетического генистеина связано с изменениями в кишечной микробиоте

Введение

Ожирение и сахарный диабет 2 типа (СД2) широко распространены и приводят к огромному бремени для здоровья и экономики.Однако этиология и патогенез ожирения и диабета до сих пор не ясны. Поскольку гипотеза о происхождении здоровья и болезней, связанных с развитием (DOHaD), была впервые выдвинута в начале 1990-х годов (1), большое количество эпидемиологических исследований (2–4) и исследований на животных (5, 6) подчеркнули важность развития окружающая среда в молодом возрасте для определения траекторий хронических заболеваний в более позднем возрасте, включая ожирение и СД2. Многочисленные недавние исследования (7, 8) и наши предыдущие исследования (9) показали, что диета матери с высоким содержанием жиров во время беременности и кормления грудью может значительно повысить предрасположенность потомства к ожирению, непереносимости глюкозы и инсулинорезистентности.Таким образом, вмешательства на раннем этапе жизни могут изменить траекторию болезни и предотвратить возникновение и развитие диабета.

Несколько крупных эпидемиологических исследований показали, что потребление соевых продуктов и изофлавонов связано с более низким риском развития СД2 (10–12). Изофлавоны сои обладают слабым эстрогеноподобным действием, а основные компоненты изофлавонов сои включают генистеин, диадзеин и глицитеин. Генистеин широко используется в качестве пищевой добавки в Соединенных Штатах и ​​исследован на предмет потенциальных эффектов на когнитивные функции, лечение рака, а также здоровье костей и сердечно-сосудистой системы (13).В последние годы растет число исследований, показывающих, что генистеин улучшает метаболизм глюкозы и липидов, и продемонстрировали, что потребление генистеина снижает уровень глюкозы в крови, триглицеридов (ТГ) и общего холестерина (ОХ), а также предотвращает увеличение веса без побочных эффектов. побочные эффекты (14–16). Регулирование выработки глюкозы в печени, усиление пролиферации β-клеток, уменьшение апоптоза, активация сигнального пути цАМФ / PKA и антиоксидантные эффекты — все это потенциальные механизмы антидиабетических функций генистеина (13).Однако в настоящее время исследования, изучающие влияние вмешательства генистеина в молодом возрасте на метаболизм глюкозы и липидов, редки.

В течение последних нескольких десятилетий микробиота кишечника стала центром медицинских исследований. Многочисленные доказательства (17–19) предполагают, что микробиота кишечника играет важную роль в метаболизме глюкозы и липидов. В последнее время растущее число исследований на людях (20) и животных (1, 21, 22) показало, что микробиота кишечника нарушена у потомков от матерей с ожирением и матерей с высоким содержанием жира.Таким образом, микробиота кишечника может играть ключевую роль в плохой среде внутриутробного развития матери, запрограммировав у потомства развитие метаболических нарушений. Кроме того, была показана связь между улучшением толерантности к глюкозе генистеином и изменениями микробиоты кишечника (23). Однако исследования воздействия материнского генистеина на микробиоту кишечника у потомства ограничены.

В текущем исследовании мы стремились изучить влияние материнского генистеина на метаболическое здоровье в раннем периоде жизни потомства женского пола и определить, может ли прием материнского генистеина обратить вспять пагубные метаболические эффекты материнской диеты с высоким содержанием жиров для женского потомства.Кроме того, мы исследовали роль микробиоты кишечника в метаболизме глюкозы и липидов у потомства.

Материалы и методы

Животные и дизайн исследования

Четырехнедельные самки мышей C57BL / 6 были получены из Национального института по контролю за продуктами питания и лекарствами (Пекин, Китай; SCXK-2014-0013). Животных содержали в контролируемых помещениях для животных при комнатной температуре 22 ± 2 ° C с 12-часовым циклом свет / темнота и кормили нормальной контрольной диетой (диета AIN-93G) с кукурузным маслом, замененным соевым маслом. После 1 недели акклиматизации к окружающей среде самки были случайным образом разделены на четыре группы и получали диету с высоким содержанием жиров без генистеина (HF, n = 6), диету с высоким содержанием жиров и низкой дозой генистеина (CAS: 466-72- 0, G0272, TCI Development Co., Ltd.) (0,25 г / кг рациона) (HF.LG, n = 6), диета с высоким содержанием жиров и высокими дозами генистеина (0,6 г / кг рациона) (HF. HG, n = 8) или нормальную контрольную диету (Control, n = 8) в течение 3 недель. Соевое масло в рационе с высоким содержанием жиров также было заменено кукурузным маслом.Ингредиенты показаны в таблице S1. В состав жирной диеты входили (ккал%): жир 60%; углеводы, 20%; и белок, 20%, с запасом энергии 5,24 ккал / г, тогда как контрольный рацион содержал (ккал%): жир 15,8%; углеводы 63,9%; и белок, 20%, с запасом энергии 3,9 ккал / г.

Самок мышей спаривали с 8-недельными самцами C57BL / 6 и кормили нормальной диетой. Самок проверяли на наличие посткопуляционных пробок каждое утро после спаривания, и появление пробок регистрировали как d 0,5 беременности. Самок кормили назначенным им рационом во время беременности и кормления грудью и имели доступ к пище и воде ad libitum . Все пометы были отбракованы до пяти щенков, чтобы не было отклонений в питании между пометами. Потомство отлучено от груди в 3-недельном возрасте. При отъеме все потомство женского пола ( n = 6–8 на группу) были забиты. Образцы крови собирали из интраорбитального ретробульбарного сплетения после 10 ч голодания у анестезированных мышей, матку и яичники удаляли и взвешивали; содержимое слепой кишки было быстро удалено, мгновенно заморожено в сухом льду и затем сохранено при -80 ° C для дальнейшего анализа.Все операции проводились под наркозом с хлоралгидратом, и прилагались все усилия, чтобы минимизировать страдания. Все процедуры были одобрены комитетом по уходу за животными и их использованием при больнице Пекинского союза медицинского колледжа (Пекин, Китай, SYXC-2014-0029). Все операции с животными проводились в соответствии с Руководством по уходу и использованию лабораторных животных.

Измерение массы тела и приема пищи

Вес тела матери и потомства измеряли один раз в неделю.Мы измеряли 3-дневное потребление пищи матерью каждую неделю, и их потребление пищи оценивалось путем взвешивания оставшейся пищи.

Тесты на толерантность к глюкозе

Пероральные тесты на толерантность к глюкозе (OGTT) были выполнены как на самках, так и на их потомках при отъеме. Мышей не кормили в течение 6 часов. Затем через желудочный зонд вводили глюкозную нагрузку (2,0 г / кг массы тела). До (0 мин) и через 30, 60 и 120 мин после желудочного зондирования концентрацию глюкозы в крови (ГК) измеряли в крови, взятой из хвостового кровотечения, с помощью глюкометра Contour TS (ACCU-CHEK Mobile, Пекин, Китай).Площадь под кривой (AUC) OGTT рассчитывалась, как описано ранее (9).

Измерение уровня инсулина, триацилглицерина и общего холестерина в сыворотке крови

Образцы крови, собранные у потомства женского пола при отъеме, центрифугировали при 3000 × g в течение 10 мин при 4 ° C, а сыворотку хранили в аликвотах при -80 ° C. Концентрации инсулина в сыворотке измеряли с помощью набора для ELISA (80-INSMSU-E01, Салем, штат Нью-Хэмпшир, США). Чувствительность к инсулину оценивали с использованием модели гомеостаза оценки инсулинорезистентности (HOMA-IR).HOMA-IR рассчитывали, как описано ранее (9). Общий холестерин сыворотки (TC) (K603-100, наборы были от BioVision, Inc., Mountain View, CA, USA) и триацилглицерин (TG) (K622-100, наборы были от BioVision Inc., Mountain View, CA, USA) измеряли колориметрическими методами.

Анализ кишечной микробиоты

Микробиоту кишечника анализировали в соответствии с методами, описанными в нашей предыдущей публикации (24). Микробную ДНК экстрагировали из содержимого слепой кишки с использованием набора QIAamp DNA Stool Mini Kit (Qiagen, Hilden, Германия).Области V3-V4 гена 16S рРНК амплифицировали с использованием праймеров 341F, 5′-CCTAYGGRBGCASCAG-3 ‘и 806R, 5′-GGACTACNNGG GTATCTAAT-3’. Ампликоны очищали с использованием набора для быстрой ПЦР-очистки (Qiagen, Hilden, Германия). Микробную 16S рДНК секвенировали на платформе Illumina HiSeq 2500 (Norcross, GA, США).

После объединения чтений с парным концом чтение было выполнено с помощью качественной фильтрации. Высококачественные чтения были присвоены операционным таксономическим единицам (OTU) на уровне сходства 97% с использованием программного обеспечения UPARSE (версия 7.0.1001) (25), а репрезентативные последовательности для каждой OTU были проверены с использованием программного обеспечения QIIME (версия 1.7.0, Quantitative Insights into Microbial Ecology) (26). Затем база данных GreenGene (27) использовалась для аннотирования таксономической информации на основе алгоритма классификатора RDP версии 2.2 (28). Относительная численность каждой OTU анализировалась на уровне типа, класса, отряда, семейства, рода и вида. Альфа- и бета-разнообразие исследовали с помощью программного обеспечения QIIME (версия 1.7.0) и рассчитали с помощью программного обеспечения R (версия 2.15.3). Для альфа-разнообразия были проанализированы Chao1, Simpson и индекс Шеннона. Для бета-разнообразия графики анализа главных компонентов (PCA) были выполнены с использованием как взвешенного, так и невзвешенного UniFrac. Кроме того, для определения различий между группами использовались линейный дискриминантный анализ (LDA) величины эффекта (LEfSe) и MetaStat.

Статистический анализ

Результаты выражаются как среднее значение ± стандартная ошибка среднего (S.E.M). Статистические данные анализировали с помощью однофакторного дисперсионного анализа и двустороннего дисперсионного анализа с использованием апостериорного анализа Тьюки и Бонферрони.Корреляции между относительной численностью таксонов бактерий на разных таксономических уровнях и метаболическими параметрами выполнялись с помощью теста коэффициента корреляции Спирмена. Поправка для корреляционного анализа по коэффициенту ложного обнаружения (FDR) с помощью процедуры Бенджамини-Хохберга была отображена программным обеспечением R (версия 2.15.3) со значениями <0,05, считающимися статистически значимыми. Анализ сходства (ANOSIM) был использован для проверки статистической значимости β-разнообразия. А р <0.05 считался статистически значимым. Для анализа MetaStat статистически значимым считалось значение q <0,05. Для статистического анализа использовали Prism версии 7.0 (GraphPad Software Inc., Сан-Диего, Калифорния, США).

Результаты

Характеристика плотин

В течение 9 недель диетического вмешательства потребление энергии самками в четырех группах существенно не отличалось. При отъеме масса тела самок с высоким содержанием жира (HF) была выше, чем у самок контрольной группы ( p <0.0001; Таблица 1). AUC OGTT была значительно выше у самок, получавших диету с высоким содержанием жиров, по сравнению с таковой у самок в контрольной группе ( p <0,05). Однако, в отличие от группы HF, масса тела и толерантность к глюкозе существенно не различались у самок, получавших либо диету с высоким содержанием жиров с низкими дозами генистеина (HF. LG), либо диету с высоким содержанием жиров с высокими дозами генистеина (HF. .HG). Не было различий между четырьмя группами в отношении размера помета, индекса матки (отношение веса матки к весу тела) или индекса яичников (отношение веса яичников к весу тела) самок.

Таблица 1 . Характеристики плотины и литра.

Масса тела при рождении и масса тела потомства

Вес при рождении потомства самок с высоким содержанием жира (HF) был ниже, чем у потомства самок контрольной группы ( p <0,05, рис. 1A). У потомков, получавших диету с высоким содержанием жиров и низкодозированных генистеиновых самок, масса тела при рождении улучшилась и была выше, чем у потомства самок группы HF ( p <0,05, рис. 1A). Однако не было различий между четырьмя группами в отношении массы тела потомства женского пола при отъеме (рисунок 1B).

Рисунок 1 . Масса тела при рождении и масса тела потомства при отъеме от груди. (A) масса тела при рождении и (B) масса тела потомства женского пола при отъеме от груди. HF — жирная диета без генистеина; HF. LG, диета с высоким содержанием жиров и низкими дозами генистеина; HF. HG, диета с высоким содержанием жиров и высокими дозами генистеина; Контрольная, нормальная контрольная диета. Данные выражены в виде средних значений ± S.E.M. ( n = 6–8 / группа). Средние значения значительно различались между другой группой и группой HF: * p <0.05.

Диетический генистеин в низких дозах предотвращает пагубное влияние рациона матери с высоким содержанием жиров на метаболизм глюкозы и чувствительность к инсулину у потомства

При отъеме у потомства от самок, получавших корм с высоким содержанием жиров (HF), была нарушена толерантность к глюкозе, измеренная с помощью OGTT, по сравнению с потомством от самок, получавших нормальный контрольный рацион (контроль). Уровни глюкозы в крови были выше через 30 минут ( p <0,0001), а AUC была значительно больше ( p <0,0001) для потомков из группы HF (Фигуры 2A, B).Чтобы определить, влияет ли материнский диетический генистеин на метаболизм глюкозы у потомства женского пола, мы сравнили потомство от самок, которых кормили диетой с высоким содержанием жиров с генистеином или без него. Как показано на фиг. 2A, B, самки самок, получавших низкие дозы генистеина (HF.LG), продемонстрировали заметное улучшение толерантности к глюкозе. Уровни глюкозы в крови через 30 минут ( p <0,0001) и AUC у этих потомков женского пола были значительно ниже ( p <0,0001). Кроме того, чтобы определить, влияет ли чувствительность к инсулину у потомства женского пола, определяли уровень инсулина в сыворотке крови натощак.Самки с высоким содержанием жира приводили к значительно более высокой концентрации инсулина ( p <0,001) и индексу HOMA-IR ( p <0,0001) у потомства при отъеме. Самки, получавшие низкие дозы генистеина (HF.LG), привели к повышению чувствительности к инсулину у их потомков (Рисунки 2C, D). Однако не было обнаружено значительных различий в отношении толерантности к глюкозе и чувствительности к инсулину между потомками женского пола из группы HF.HG и группы HF (Рисунки 2A – D). Кроме того, между потомками HF не было выявлено значимых различий.Группы HG и HF. LG отличаются по уровням глюкозы в крови в разное время во время теста на толерантность к глюкозе, уровням инсулина в сыворотке и HOMA-IR, за исключением значительно более низкой AUC у потомков группы HF.LG ( p <0,001) .

Рисунок 2 . Метаболизм глюкозы у потомства женского пола при отъеме. (А) ОГТТ; (B) AUC; (C) Уровни инсулина в сыворотке; (D) HOMA-IR. HF — жирная диета без генистеина; HF. LG, диета с высоким содержанием жиров и низкими дозами генистеина; HF.HG, диета с высоким содержанием жиров и высокими дозами генистеина; Контрольная, нормальная контрольная диета; OGTT, пероральный тест на толерантность к глюкозе; AUC — площадь под кривой; HOMA-IR, модель гомеостаза для оценки инсулинорезистентности. Данные выражены в виде средних значений ± S.E.M. ( n = 6-8 / группа). Средние значения достоверно различались между другой группой и группой с HF: * p <0,05, ** p <0,01, *** p <0,001, **** p <0,0001; Средние значения значительно различались между контрольной группой и группой HF: «a» p <0. 0001; Средние значения значительно различались между группой HF.LG и группой HF: «b» p <0,001.

Высокодозный генистеин для материнского рациона улучшает липидный метаболизм в раннем периоде жизни потомства

Помимо метаболизма глюкозы, мы определяли уровни липидов в сыворотке крови, чтобы оценить различия между группами в отношении метаболизма липидов у потомства женского пола при отъеме. Уровни сывороточных ТГ ( p <0,05, рис. 3A) и TC ( p <0.01, Рисунок 3B) у потомства самок с высоким содержанием жира (HF) были выше, чем у потомства самок контрольной группы. Кормление самок высокими дозами генистеина (HF.HG) привело к значительному улучшению сывороточных ТГ ( p <0,01, фиг. 3A) и уровней TC ( p <0,01, фиг. 3B) у потомства женского пола. В отличие от изменений толерантности к глюкозе и чувствительности к инсулину, не было существенной разницы в уровнях липидов в сыворотке между потомками группы HF.LG и группы HF.

Рисунок 3 . Липидный обмен у потомства женского пола при отъеме. (A) Триациглицерин сыворотки; и (B) общий холестерин сыворотки. HF — жирная диета без генистеина; HF. LG, диета с высоким содержанием жиров и низкими дозами генистеина; HF. HG, диета с высоким содержанием жиров и высокими дозами генистеина; Контрольная, нормальная контрольная диета. Данные выражены в виде средних значений ± S.E.M ( n = 6-8 / группа). Средние значения значительно различались между другой группой и группой HF: * p <0.05, ** p <0,01.

Влияние материнского диетического генистеина на кишечную микробиоту у потомства

Чтобы изучить механизмы улучшения материнского диетического генистеина метаболизма глюкозы и липидов у потомства, мы проанализировали изменения кишечной микробиоты у потомства с использованием последовательностей гена 16s рДНК. Данные о последовательностях в этом исследовании были отправлены в базу данных Sequence Read Archive (SRA) (номер доступа SRP156380). Всего было получено 1836395 высококачественных считываний из 28 образцов, в среднем 65586 последовательностей на образец.После кластеризации на уровне сходства 97% среди четырех групп было идентифицировано 653 операционных таксономических единицы (OTU). Анализ альфа-разнообразия показал, что между группами существовало параллельное богатство сообщества (Чао 1) и разнообразие (индекс Симпсона и Шеннона) (таблица S2, рисунок S1). Чтобы сравнить общую структуру микробного сообщества кишечника, был проведен анализ главных компонентов (PCA) для определения различий между группами. Как показано на рисунке 4, микробные сообщества кишечника были хорошо разделены в группе HF по сравнению с обеими контрольной группой ( p <0.01) и группы HF.HG ( p <0,05) с вариациями 55,76 и 22,51%, объясняемыми главным компонентом (PC) 1 и PC2, соответственно. Результаты были подтверждены ANOSIM и показали, что существенные различия в микробной структуре были вызваны рационом матери до беременности, беременности и кормления грудью. Этот результат также был подтвержден тепловой картой в соответствии с уровнем родов бактерий в четырех группах (рис. 5).

Рисунок 4 . Графики PCA кишечных сообществ потомства женского пола при отъеме ( n = 6–8 / группа).HF — жирная диета без генистеина; HF. LG, диета с высоким содержанием жиров и низкими дозами генистеина; HF. HG, диета с высоким содержанием жиров и высокими дозами генистеина; Контрольная, нормальная контрольная диета.

Рисунок 5 . Анализ тепловой карты многочисленных родов в каждой группе ( n = 6–8 / группа). HF — жирная диета без генистеина; HF. LG, диета с высоким содержанием жиров и низкими дозами генистеина; HF. HG, диета с высоким содержанием жиров и высокими дозами генистеина; Контрольная, нормальная контрольная диета.

Произошли значительные изменения в составе кишечного микробного сообщества среди четырех групп.Анализ MetaStat показал, что филум Proteobacteria, класс Deltaproteobacteria, семейство Desulfovibrionaceae и род Desulfovibrio были значительно выше в группе HF по сравнению с контрольной группой ( q <0,05), а также были относительно ниже в группе HF. LG. группы и группы HF.HG по сравнению с группой HF. Однако была более низкая относительная численность семейства Porphyromonadaceae , рода Ruminoccaceae_UCG-004 , рода [Eubacterium] _brachy_group , рода Rikenella и рода Rikenellaceae_RC9_gut_group в контрольной группе по сравнению с контрольной группой в группе HF в контрольной группе. q <0.05), все из которых также имели тенденцию к увеличению у потомства женского пола при отъеме от материнского диетического лечения генистеином по сравнению с потомством от самок, получавшим диету с высоким содержанием жиров без генистеина. Роды Rikenella и Rikenellaceae_RC9_gut_group , оба из семейства Rikenellaceae , были значительно увеличены в группе HF.HG по сравнению с группой HF и могут играть важную роль в метаболизме липидов (Рисунки 6A – I). На рисунке 7 перечислены значительные изменения микробиоты от уровня филума до уровня вида, выполненные с помощью LEfSe. Тип Firmucutes, класс Clostridia, семейство Rikenellaceae , семейство Porphyromonadaceae , род Alistipes и род Anaerotruncus были значительно обогащены в контрольной группе. Тип Proteobacteria, класс Deltaproteobacteria, отряд Desulfovibrionales, семейство Desulfovibrionaceae и род Desulfovibrio показали более высокую численность в группе HF. Обработка генистеином низкой и высокой дозой увеличивала содержание Bacteroides и Akkermansia на уровне рода (Фигуры 7A, B).Напротив, вид Bacteroides_acidifaciens был однозначно обогащен группой HF.HG (рис. 7B).

Рисунок 6 . Относительное количество таксонов бактерий на разных таксономических уровнях в каждой группе. ( n = 6–8 / группа). (A) Proteobacteria; (B) дельтапротеобактерии; (C) Porphyromonadaceae ; (D) Desulfovibrionaceae ; (E) Desulfovibrio ; (F) Ruminococcaceae_UCG-004 ; (G) [Eubacterium] _brachy_group ; (В) Рикенелла ; и (I) Rikenellaceae_RC9_gut_group . HF — жирная диета без генистеина; HF. LG, диета с высоким содержанием жиров и низкими дозами генистеина; HF. HG, диета с высоким содержанием жиров и высокими дозами генистеина; Контрольная, нормальная контрольная диета. Данные были проанализированы с помощью MetaStat. Средние значения достоверно различались между другой группой и группой с сердечной недостаточностью: * q <0,05, ** q <0,01.

Рисунок 7 . Анализ LEfSe различной микробиоты кишечника от уровня филума до уровня вида ( n = 6–8 / группа). (A) Различно обогащенные бактерии из группы HF-HF.LG-Control; и (B) Различно обогащенные бактерии из группы HF-HF.HG-Control. HF — жирная диета без генистеина; HF. LG, диета с высоким содержанием жиров и низкими дозами генистеина; HF. HG, диета с высоким содержанием жиров и высокими дозами генистеина; Контрольная, нормальная контрольная диета.

Корреляционный анализ микробиоты кишечника и параметров метаболизма глюкозы и липидов

Для оценки связи между метаболизмом глюкозы и липидов и микробиотой кишечника у потомства AUC уровней OGTT, инсулина, HOMA-IR, TC и TG коррелировали с относительной численностью кишечных бактерий (таблица 2). AUC OGTT, уровни инсулина натощак, HOMA-IR и уровни TC в сыворотке положительно коррелировали с относительной численностью Proteobacteria на уровне филума и класса Deltaproteobacteria из филума Proteobacteria. Однако концентрация инсулина в сыворотке натощак и HOMA-IR отрицательно коррелировали с классом Clostridia (тип Firmicutes). На уровне семьи AUC OGTT, уровни инсулина, HOMA-IR и уровни TC в сыворотке положительно коррелировали с численностью Desulfovibrionaceae из класса Deltaproteobacteria.Напротив, AUC OGTT, уровни инсулина и HOMA-IR отрицательно коррелировали с семейством Porphyromonadaceae и уровнями инсулина, а HOMA-IR оба отрицательно коррелировали с Rikenellaceae , оба из которых принадлежат к типу Bacteroidetes. На уровне рода AUC OGTT, инсулина и HOMA-IR положительно коррелировали с родом Desulfovibrio из филы Firmicutes, но инсулин и HOMA-IR отрицательно коррелировали с Alistipes и Rikenella из тип Bacteroidetes.Кроме того, HOMA-IR также положительно коррелировал с видом Bacteroides_acidifaciens . Что касается метаболизма липидов, TC положительно коррелировал с родом Desulfovibrio .

Таблица 2 . Анализ корреляции между относительной численностью таксонов бактерий на различных таксономических уровнях и параметрами метаболизма глюкозы и липидов ( n = 6–8 / группа).

Обсуждение

Точно установлено, что плохое питание матери является важным фактором в развитии метаболических нарушений у потомства (29–32), что, возможно, способствовало нынешнему быстрому росту распространенности ожирения и диабета.Точно так же настоящее исследование также продемонстрировало, что диета с высоким содержанием жиров до беременности, а также во время беременности и кормления грудью может привести к непереносимости глюкозы, инсулинорезистентности и более высоким уровням ТХ и ТГ в сыворотке крови потомства женского пола. Сообщалось, что генистеин обладает антидиабетической (13) и улучшающей липидный метаболизм функциями (33), но влияние приема генистеина во время беременности и кормления грудью на метаболизм глюкозы и липидов у потомства недостаточно изучено. В настоящем исследовании мы изучили влияние материнского диетического генистеина на глюкозный и липидный обмен у потомства женского пола при отъеме от груди. Мы обнаружили, что низкие дозы генистеина в рационе матери (0,25 г / кг диеты) полностью нейтрализовали пагубное влияние рациона матери с высоким содержанием жиров на толерантность к глюкозе, циркулирующий инсулин, HOMA-IR и вес при рождении у потомства женского пола. Более того, нарушения липидных профилей сыворотки у потомства из-за рациона матери с высоким содержанием жиров были предотвращены, если самкам скармливать высокие дозы генистеина (0.6 г / кг диеты). Индекс матки и яичников показал, что вмешательство генистеина не оказало неблагоприятного воздействия на матери. Эти данные показывают, что кормовой генистеин матери имеет решающее значение для улучшения метаболического здоровья в раннем возрасте женского потомства в зависимости от дозы.

Могут произойти изменения во многих организациях потомства, которые играют важную роль в благотворном влиянии генистеина материнского питания и пагубном влиянии материнского рациона с высоким содержанием жиров на метаболические нарушения у потомства. Учитывая жизненно важную роль, которую кишечное микробное сообщество играет в метаболическом здоровье, мы предположили, что кишечная микробиота потомства изменилась. Действительно, наши результаты показали, что кормление матери с высоким содержанием жиров привело к значительным изменениям в общей структуре и составе кишечного микробного сообщества и что потребление материнского генистеина полностью изменило эти пагубные эффекты. Настоящее исследование показало, что Proteobacteria, Deltaproteobacteria, Desulfovibrionales, Desulfovibrionaceae и Desulfovibrio значительно увеличивались и были положительно коррелированы с параметрами метаболизма глюкозы и липидов, тогда как Porphyromonadaceae, Ruminoccaceae_UCG_Rcg-004 и значительно снизились и были отрицательно коррелированы с параметрами метаболизма глюкозы и липидов у потомства самок от самок с высоким содержанием жира по сравнению с таковым у потомства самок самок контрольной группы.Как было показано ранее, кормление с высоким содержанием жиров привело к значительному увеличению численности Proteobacteria Desulfovibrionaceae . Tomas et al. (34) обнаружили, что диета с высоким содержанием жиров изменила состав микробного сообщества фекалий и слепой кишки даже после 30 дней потребления и что относительное количество Proteobacteria значительно увеличилось. У Proteobacteria основное увеличение произошло в классе Deltaproteobacteria (порядок Desulfovibrionales, семейство Desulfovibrionaceae ). Между тем, физическая целостность эпителиального барьера была нарушена, и кишечная проницаемость увеличилась.Точно так же другое предыдущее исследование показало, что кишечная микробиота мышей дикого типа, перешедших на диеты с высоким содержанием жиров, сильно изменилась, включая увеличение протеобактерий. Относительная численность основной группы Proteobacteria увеличилась, так же как и класса DeltaProteobacteria и рода Desulfovibrio (35). Несколько родов, принадлежащих к семейству Desulfovibrionaceae , считаются условно-патогенными микроорганизмами и связаны с некоторыми воспалительными заболеваниями (36, 37). Эти виды продуцируют эндотоксины и обладают способностью восстанавливать сульфат до H 2 S (38), тем самым повреждая кишечный барьер (39). Пищевой генистеин матери снижает численность этих бактерий и обращает их пагубное влияние на метаболизм. Кроме того, Ли и др. (40) проанализировали влияние антибиотика азитромицина на микробиоту кишечника и адипогенез у мышей и обнаружили, что количество Rikenella было значительно ниже в группе азитромицина и было связано с более высокой массой тела и большим процентным содержанием жира в организме.Другое исследование на людях также показало, что обилие Rikenellaceae , наряду с другими бактериальными компонентами, способствовало худощавому типу телосложения (41). В настоящем исследовании высокие дозы генистеина в рационе матери значительно увеличили численность Rikenella и Rikenellaceae_ RC9_ gut_group и улучшили уровни TG и TC у потомства женского пола при отъеме от груди. Таким образом, род Rikenella и Rikenellaceae_ RC9_ gut_group может играть решающую роль в улучшении липидного метаболизма с помощью высоких доз генистиена.

В текущем исследовании на уровне рода материнский диетический генистеин (включая HF.LG и HF.HG) значительно обогатил Bacteroides и Akkermansia . Несколько исследований на людях показали, что относительная численность Bacteroides была снижена у пациентов с диабетом 2 типа по сравнению с нормальными контрольными субъектами (42, 43). Диета с богатым клетчаткой макробиотиком Ma-Pi 2 увеличивала количество продуцентов пропионата ( Bacteroides ) (42). Кроме того, другое исследование на мышах с ожирением показало, что ресвератрол улучшает толерантность к глюкозе, одновременно увеличивая относительное количество Bacteroides (44).Наше исследование показало, что Bacteroides было обогащено потомством женского пола от самок, получавших генистеин, и могло сыграть решающую роль в устранении пагубного воздействия плохой материнской диеты на метаболизм потомства. Благоприятное влияние потребления материнского генистеина на метаболизм потомства также было связано со значительным обогащением относительной численности Akkermansia , что могло поддерживать толщину слоя слизи и уменьшать утечку ЛПС и кишечную проницаемость (45).

Насколько нам известно, это первое исследование, которое показало, что генистеин фитоэстрогена оказывает значительное влияние на численность Akkermansia в кишечном микробном сообществе на животной модели метаболических нарушений у потомства, вызванных диетой с высоким содержанием жиров. Недавно сообщалось, что введение полифенолов также было связано с увеличением численности Akkermansia как в исследованиях на людях, так и на животных (46, 47). Более того, увеличение доли этой бактерии в кишечнике также было связано с благоприятным воздействием на метаболизм антидиабетического препарата метформин и желудочного шунтирования (48, 49).Хотя мы не определили напрямую причинно-следственную связь между увеличением доли Akkermansia и улучшением метаболизма глюкозы и липидов у потомства от самок, потребляющих генистеин, кормящих с высоким содержанием жира, сообщалось, что пероральное введение Akkermansia обращает метаболические аномалии индуцируется диетой с высоким содержанием жиров (45), а также имитирует антидиабетические эффекты метформина у мышей с диабетом (48). Что еще более важно, наши результаты показали, что увеличение Akkermansia , связанное с генистеином, может быть достаточным для улучшения метаболических нарушений у потомства, вызванных материнской диетой с высоким содержанием жиров, без значительных изменений в пропорциях Firmicutes и Bacteroidetes.

Кроме того, анализ LEfSe показал, что вид Bacteroides_acidifaciens был однозначно обогащен группой HF.HG. Renouf et al. (50) впервые идентифицировали фекальные микробы, которые были ответственны за разложение изофлавона, используя молекулярно-генетические методы, и продемонстрировали, что Bacteroides_acidifaciens увеличивают исчезновение изофлавоногенистеина в человеческих фекалиях при инкубации в анаэробных и богатых питательными веществами условиях, что указывает на то, что Bacteroides_acidifaciens играли роль в метаболизме генистеина в кишечнике.Таким образом, обогащение Bacteroides_acidifaciens группой HF.HG увеличивало деградацию изофлавонов генистеина. Корреляционный анализ показал, что относительная численность Bacteroides_acidifaciens была положительно связана с HOMA-IR, что прояснило различия в эффектах материнских низких доз генистеина и высоких доз генистеина на метаболизм глюкозы и чувствительность к инсулину у потомства.

Таким образом, материнский диетический генистеин, полученный до и во время беременности и кормления грудью, значительно улучшил метаболизм потомства женского пола в раннем возрасте и компенсировал пагубные последствия рациона матери с высоким содержанием жиров.Улучшение метаболизма глюкозы и липидов связано с изменениями микробиоты кишечника потомства. Это первое исследование, в котором сообщается о роли, которую микробиота кишечника играет в влиянии материнского диетического генистеина на метаболизм глюкозы и липидов у потомства женского пола. Однако в нашем исследовании была проанализирована только взаимосвязь между микробиотой кишечника и метаболизмом у потомства, а причинно-следственная связь все еще требует дальнейшего изучения. Кроме того, в этом исследовании изучалось только потомство женского пола.Влияние материнского диетического генистеина на метаболическое здоровье потомства мужского пола заслуживает изучения в будущем. Наши результаты показывают, что обеспечение матери генистеином в рационе матери до беременности, а также во время беременности и кормления грудью может быть важным инструментом в борьбе с ожирением и диабетом у потомства.

Доступность данных

Наборы данных, подтверждающие выводы этой рукописи, доступны у соответствующего автора по разумному запросу.

Авторские взносы

XX и JZ разработали эксперименты.LZ, XW, MD, RL и XZ проводили эксперименты. LZ проанализировал данные и написал первоначальный черновик. XX, JZ, QZ, ML и MY просмотрели рукопись. Все авторы получили окончательное одобрение представленной версии.

Финансирование

Эта работа была поддержана грантами Национальной программы ключевых исследований и разработок Китая (2017YFC1309603), Национальной программы ключевых исследований и разработок Китая (2016YFA0101002), Национального фонда естественных наук Китая (№№ 81170736, 81570715, 81870579 и 81870545), Исследовательский центр медицинской эпигенетики Китайской академии медицинских наук (2017PT31036). Спонсоры не принимали участия в разработке, анализе или написании этой статьи.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

Благодарности

Мы очень благодарны компании Beijing Compass Biotechnology за их техническую поддержку с последовательностями 16s рРНК.

Дополнительные материалы

Дополнительные материалы к этой статье можно найти в Интернете по адресу: https: // www.frontiersin.org/articles/10.3389/fendo.2018.00516/full#supplementary-material

Список литературы

1. Галлей Д.Д., Бейли М., Камп Даш К., Шоппе-Салливан С., Кристиан Л.М. Материнское ожирение связано с изменениями микробиома кишечника у малышей. PLoS ONE (2014) 9: e113026. DOI: 10.1371 / journal.pone.0113026

PubMed Аннотация | CrossRef Полный текст | Google Scholar

2. Хорнайваз Ф.Р., Фолленвейдер П., Бохуд М., Мозер В., Вэбер Г., Маркес-Видаль П.Низкий вес при рождении приводит к ожирению, диабету и повышению уровня лептина у взрослых: исследование CoLaus. Cardiovasc Diabetol. (2016) 15:73. DOI: 10.1186 / s12933-016-0389-2

PubMed Аннотация | CrossRef Полный текст | Google Scholar

3. Эрикссон Дж. Г., Сандбоге С., Салонен М. К., Каянти Е., Осмонд С. Долгосрочные последствия избыточного веса матери во время беременности для последующего здоровья потомства: результаты Хельсинкского когортного исследования рождения. Ann Med. (2014) 46: 434–8. DOI: 10.3109 / 07853890.2014.919728

PubMed Аннотация | CrossRef Полный текст | Google Scholar

4. Сяо Х, Чжан З. X, Коэн Х. Дж., Ван Х, Ли В, Ван Т. и др. Доказательства связи между массой тела при рождении и более поздним диабетом и нарушением регуляции глюкозы у населения Китая. Уход за диабетом. (2008) 31: 483–7. DOI: 10.2337 / dc07-1130

PubMed Аннотация | CrossRef Полный текст | Google Scholar

5. Охта Т., Торинива Ю., Рюмон Н., Инаба Н., Хирао Т., Яманака С. и др.Диета матери с высоким содержанием жиров способствует развитию диабета у потомства крыс. Anim Sci J. (2017) 88: 149–55. DOI: 10.1111 / asj.12606

PubMed Аннотация | CrossRef Полный текст | Google Scholar

6. Seet EL, Yee JK, Jellyman JK, Han G, Ross MG, Desai M. Материнская диета с высоким содержанием жиров. Программы метаболизма жирных кислот в печени потомства крыс. Липиды (2015) 50: 565–73. DOI: 10.1007 / s11745-015-4018-8

PubMed Аннотация | CrossRef Полный текст | Google Scholar

7.Сеговия С.А., Викерс М.Х., Харрисон К.Дж., Патель Р., Грей С., Рейнольдс К.М. Диеты с высоким содержанием жиров и соли для матери имеют дифференциальные программные эффекты на метаболизм потомства взрослых самцов крыс. Передняя гайка. (2018) 5: 1. DOI: 10.3389 / fnut.2018.00001

PubMed Аннотация | CrossRef Полный текст | Google Scholar

8. Келехер М.Р., Заиди Р. , Шах С., Окли М.Э., Павлатос С., Эль Идрисси С. и др. Диета матери с высоким содержанием жиров связана с измененной экспрессией генов, метилированием ДНК и риском ожирения у потомства мышей. PLoS ONE (2018) 13: e0192606. DOI: 10.1371 / journal.pone.0192606

PubMed Аннотация | CrossRef Полный текст | Google Scholar

9. Чжэн Дж., Сяо Х, Чжан К., Ю М., Сюй Дж., Ван З. Высокожировая диета матери модулирует гомеостаз липидов глюкозы в печени и экспрессию генов в пути PPAR в раннем возрасте потомства. Int J Mol. Sci. (2014) 15: 14967–83. DOI: 10.3390 / ijms150914967

PubMed Аннотация | CrossRef Полный текст | Google Scholar

10.Нанри А., Мидзуэ Т., Такахаши Ю., Кири К., Иноуэ М., Нода М. и др. Потребление соевых продуктов и изофлавонов связано с более низким риском развития диабета 2 типа у японских женщин с избыточным весом. J Nutr. (2010) 140: 580–6. DOI: 10.3945 / jn.109.116020

PubMed Аннотация | CrossRef Полный текст | Google Scholar

11. Динг М., Пан А., Мэнсон Дж. Э., Виллетт В. К., Малик В., Рознер Б. и др. Потребление соевых продуктов и изофлавонов и риск диабета 2 типа: объединенный анализ трех когорт в США. евро J Clin Nutr. (2016) 70: 1381–7. DOI: 10.1038 / ejcn.2016.117

PubMed Аннотация | CrossRef Полный текст | Google Scholar

12. Одегаард А.О., Ко В.П., Батлер Л.М., Дюваль С., Гросс М.Д., Ю. М.К. и др. Особенности питания и случаи диабета 2 типа у китайских мужчин и женщин: исследование здоровья сингапурского Китая. Уход за диабетом (2011) 34: 880–5. DOI: 10.2337 / dc10-2350

PubMed Аннотация | CrossRef Полный текст | Google Scholar

13. Гилберт Э. Р., Лю Д.Антидиабетические функции генистеина изофлавона сои: механизмы, лежащие в основе его влияния на функцию бета-клеток поджелудочной железы. Food Funct. (2013) 4: 200–12. DOI: 10.1039 / c2fo30199g

PubMed Аннотация | CrossRef Полный текст | Google Scholar

14. Squadrito F, Marini H, Bitto A, Altavilla D, Polito F, Adamo EB, et al. Генистеин при метаболическом синдроме: результаты рандомизированного клинического исследования. J Clin Endocrinol Metabol. (2013) 98: 3366–74. DOI: 10.1210 / JC.2013-1180

PubMed Аннотация | CrossRef Полный текст | Google Scholar

15. Guo TL, Germolec DR, Zheng JF, Kooistra L., Auttachoat W., Smith MJ, et al. Генистеин защищает самок мышей с диабетом, не страдающих ожирением, от развития диабета 1 типа, когда их кормят диетой без сои и люцерны. Toxicol Pathol. (2015) 43: 435–48. DOI: 10.1177 / 0192623314526318

PubMed Аннотация | CrossRef Полный текст | Google Scholar

16. Симперова А., Аль-Наккаш Л., Фауст Дж. Дж., Sweazea KL.Добавка генистеина предотвращает увеличение веса, но способствует окислительному стрессу и воспалению в сосудистой сети самок мышей ob / ob с ожирением. Nutr Res. (2016) 36: 789–97. DOI: 10.1016 / j.nutres.2016.03.011

PubMed Аннотация | CrossRef Полный текст | Google Scholar

18. Липперт К., Кеденко Л., Антониелли Л., Кеденко И., Гемайер С., Лейтнер М. и др. Дисбактериоз кишечной микробиоты, связанный с нарушениями метаболизма глюкозы и метаболическим синдромом у пожилых людей. Benef Microbes (2017) 8: 545–556.DOI: 10.3920 / BM2016.0184

PubMed Аннотация | CrossRef Полный текст | Google Scholar

19. Шан Й., Хафипур Э., Дерахшани Х., Сарна Л.К., Ву К.В., Сиоу Ю.Л. и др. Краткосрочная диета с высоким содержанием жиров вызывает вызывающие ожирение изменения в микробиоте кишечника мышей, которые частично обращаются вспять при прекращении диеты с высоким содержанием жиров. Липиды (2017) 52: 499–511. DOI: 10.1007 / s11745-017-4253-2

PubMed Аннотация | CrossRef Полный текст | Google Scholar

20. Tun HM, Bridgman SL, Chari R, Field CJ, Guttman DS, Becker AB, et al.Роль способа рождения и микробиоты кишечника младенца в передаче избыточного веса и ожирения от матери к потомству из поколения в поколение. JAMA Pediatr. (2018) 172: 368–77. DOI: 10.1001 / jamapediatrics.2017.5535

PubMed Аннотация | CrossRef Полный текст | Google Scholar

22. Чу Д.М., Мейер К.М., Принц А.Л., Аагаард К.М. Влияние питания матери во время беременности и кормления грудью на микробный состав и функцию кишечника потомства. Кишечные микробы (2016) 7: 459–70. DOI: 10.1080 / 19490976.2016.1241357

PubMed Аннотация | CrossRef Полный текст | Google Scholar

23. Хуанг Г, Сюй Дж., Лефевер Д.Э., Гленн Т.К., Надь Т., Го Т.Л. Генистеин предотвращение гипергликемии и улучшение толерантности к глюкозе у взрослых мышей с диабетом без ожирения связаны с изменениями микробиома кишечника и иммунного гомеостаза. Toxicol Appl Pharmacol. (2017) 332: 138–48. DOI: 10.1016 / j.taap.2017.04.009

PubMed Аннотация | CrossRef Полный текст | Google Scholar

24.Чжан Кью, Сяо Х, Ли М, Ю М, Пинг Ф, Чжэн Дж и др. Вилдаглиптин увеличивает количество бактерий, продуцирующих бутират, в кишечнике крыс с диабетом. PLoS ONE (2017) 12: e0184735. DOI: 10.1371 / journal.pone.0184735

PubMed Аннотация | CrossRef Полный текст | Google Scholar

26. Капорасо Дж. Г., Кучински Дж., Стомбо Дж., Биттингер К., Бушман Ф. Д., Костелло Е. К. и др. QIIME позволяет анализировать высокопроизводительные данные секвенирования сообщества. Nat Methods (2010) 7: 335–6. DOI: 10.1038 / nmeth.f.303

PubMed Аннотация | CrossRef Полный текст | Google Scholar

27. ДеСантис Т.З., Хугенхольц П., Ларсен Н., Рохас М., Броди Е.Л., Келлер К. и др. Greengenes, проверенная химерами база данных генов 16S рРНК и рабочая среда, совместимая с ARB. Appl Environ Microbiol. (2006) 72: 5069–72. DOI: 10.1128 / aem.03006-05

PubMed Аннотация | CrossRef Полный текст | Google Scholar

28. Ван Кью, ГЭ Гаррити, Тьедже Дж. М., Коул Дж. Р.. Наивный байесовский классификатор для быстрого отнесения последовательностей рРНК к новой бактериальной таксономии. Appl Environ Microbiol. (2007) 73: 5261–7. DOI: 10.1128 / aem.00062-07

PubMed Аннотация | CrossRef Полный текст | Google Scholar

29. Уоткинс А.Дж., Лукас Э.С., Уилкинс А., Кагампанг FR, Флеминг Т.П. Низкобелковая диета матери в период беременности и беременности влияет на рост потомства мышей, сердечно-сосудистый и жировой фенотип в возрасте 1 года. PLoS ONE (2011) 6: e28745. DOI: 10.1371 / journal.pone.0028745

PubMed Аннотация | CrossRef Полный текст | Google Scholar

30.Шапиро А.Л., Каар Дж.Л., Крум Т.Л., Старлинг А.П., Сига-Риз А.М., Рингхэм Б.М. и др. Качество питания матери при беременности и ожирении новорожденных: исследование «Здоровое начало». Int J Obes (Lond) (2016) 40: 1056–62. DOI: 10.1038 / ijo.2016.79

PubMed Аннотация | CrossRef Полный текст | Google Scholar

31. Хоффман М.Л., Пек К.Н., Вегжин Дж.Л., Рид С.А., Зинн С.А., Говони К.Е. Плохое питание матери во время беременности изменяет экспрессию генов, участвующих в развитии мышц и метаболизме у ягнят. J Anim Sci. (2016) 94: 3093–9. DOI: 10.2527 / jas.2016-0570

PubMed Аннотация | CrossRef Полный текст | Google Scholar

32. Стэнфорд К.И., Такахаши Х., Со К., Алвес-Вагнер А.Б., Принц Н.Б., Лениг А.С. и др. Физические упражнения матери улучшают толерантность к глюкозе у потомства женского пола. Диабет (2017) 66: 2124–36. DOI: 10.2337 / db17-0098

PubMed Аннотация | CrossRef Полный текст | Google Scholar

33. Тан Ц., Чжан К., Чжао К., Чжан Дж. Влияние диетического генистеина на липиды плазмы и печени, экспрессию генов печени и метаболические профили в плазме хомяков с гиперлипидемией, вызванной диетой. J Agric Food Chem. (2015) 63: 7929–36. DOI: 10.1021 / acs.jafc.5b01590

PubMed Аннотация | CrossRef Полный текст | Google Scholar

34. Томас Дж., Мулет С., Саффариан А., Кэвин Дж. Б., Дюкрок Р., Ренье Б. и др. Диета с высоким содержанием жиров изменяет путь PPAR-гамма, что приводит к нарушению микробной и физиологической экосистемы в тонком кишечнике мышей. Proc Natl Acad Sci USA. (2016) 113: E5934-43. DOI: 10.1073 / pnas.1612559113

PubMed Аннотация | CrossRef Полный текст | Google Scholar

35.Hildebrandt MA, Hoffmann C, Sherrill-Mix SA, Keilbaugh SA, Hamady M, Chen YY и др. Диета с высоким содержанием жиров определяет состав микробиома кишечника мышей независимо от ожирения. Гастроэнтерология (2009) 137: 1716–24.e1-2. DOI: 10.1053 / j.gastro.2009.08.042

PubMed Аннотация | CrossRef Полный текст | Google Scholar

36. Loubinoux J, Mory F, Pereira IA, Le Faou AE. Бактериемия, вызванная штаммом Desulfovibrio, относящимся к временно названному Desulfovibrio fairfieldensis. J Clin Microbiol. (2000) 38: 931–4.

PubMed Аннотация | Google Scholar

37. Weglarz L, Dzierzewicz Z, Skop B, Orchel A, Parfiniewicz B, Wisniowska B, et al. Липополисахариды Desulfovibrio desulfuricans индуцируют секрецию ИЛ-6 и ИЛ-8 эндотелиальными клетками и экспрессию Е-селектина и VCAM-1. Cell Mol Biol Lett. (2003) 8: 991–1003.

PubMed Аннотация | Google Scholar

38. Вагнер М, Роджер А.Дж., Лен Дж.Л., Брюссо, Джорджия, Шталь Д.А.Филогения диссимиляционных сульфитредуктаз подтверждает раннее происхождение сульфатного дыхания. J Bacteriol. (1998) 180: 2975–82.

PubMed Аннотация | Google Scholar

39. Якобссон Х. Э., Родригес-Пинейро А. М., Шутте А., Эрмунд А., Бойсен П., Бемарк М. и др. Состав микробиоты кишечника формирует слизистый барьер толстой кишки. EMBO Rep. (2015) 16: 164–77. DOI: 10.15252 / embr.201439263

PubMed Аннотация | CrossRef Полный текст | Google Scholar

40.Ли Р, Ван Х, Ши Кью, Ван Н, Чжан З., Сюн С. и др. Влияние перорального флорфеникола и азитромицина на микробиоту кишечника и адипогенез у мышей. PLoS ONE (2017) 12: e0181690. DOI: 10.1371 / journal.pone.0181690

PubMed Аннотация | CrossRef Полный текст | Google Scholar

41. Oki K, Toyama M, Banno T., Chonan O, Benno Y, Watanabe K. Всесторонний анализ фекальной микробиоты здоровых взрослых японцев показывает новую бактериальную линию, связанную с фенотипом, характеризующимся высокой частотой испражнений и худощавый тип телосложения. BMC Microbiol. (2016) 16: 284. DOI: 10.1186 / s12866-016-0898-x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

42. Кандела М., Бьяджи Е., Соверини М., Консоланди С., Кверчия С., Севернини М. и др. Модуляция дисбиоза кишечной микробиоты у пациентов с диабетом 2 типа с помощью диеты с макробиотиком Ma-Pi 2. руб. J Nutr. (2016) 116: 80–93. DOI: 10,1017 / s0007114516001045

PubMed Аннотация | CrossRef Полный текст | Google Scholar

43. Чжан Х, Шен Д., Фанг З., Цзе З., Цю Х, Чжан С. и др.Изменения микробиоты кишечника человека показывают прогрессирование непереносимости глюкозы. PLoS ONE (2013) 8: e71108. DOI: 10.1371 / journal.pone.0071108

PubMed Аннотация | CrossRef Полный текст | Google Scholar

44. Сунг М.М., Ким Т.Т., Дену Э., Солтис С.М., Хамза С.М., Бирн Нью-Джерси и др. Улучшение гомеостаза глюкозы у мышей с ожирением, получавших ресвератрол, связано с изменениями в микробиоме кишечника. Диабет (2017) 66: 418–25. DOI: 10.2337 / db16-0680

PubMed Аннотация | CrossRef Полный текст | Google Scholar

45.Эверард А., Белцер С., Геуртс Л., Оуверкерк Дж. П., Друарт С., Биндельс Л. Б. и др. Взаимодействие между Akkermansia muciniphila и кишечным эпителием контролирует ожирение, вызванное диетой. Proc Natl Acad Sci USA. (2013) 110: 9066–71. DOI: 10.1073 / pnas.1219451110

PubMed Аннотация | CrossRef Полный текст | Google Scholar

46. Анхе Ф.Ф., Рой Д., Пилон Г., Дудонн С., Матаморос С., Варин Т.В. и др. Экстракт клюквы, богатый полифенолами, защищает от ожирения, вызванного диетой, инсулинорезистентности и воспаления кишечника в сочетании с повышенным содержанием Akkermansia spp.популяция микробиоты кишечника мышей. Кишечник (2015) 64: 872–83. DOI: 10.1136 / gutjnl-2014-307142

PubMed Аннотация | CrossRef Полный текст | Google Scholar

47. Кемперман Р.А., Гросс Дж., Мондот С., Поссемиерс С., Марзорати М., Ван де Виле Т. и др. Влияние полифенолов из черного чая и красного вина / виноградного сока на микробиом модели кишечника. Food Res Int. (2013) 53: 659–69. DOI: 10.1016 / j.foodres.2013.01.034

CrossRef Полный текст | Google Scholar

48.Shin NR, Lee JC, Lee HY, Kim MS, Whon TW, Lee MS и др. Увеличение численности Akkermansia spp. Популяция, индуцированная лечением метформином, улучшает гомеостаз глюкозы у мышей с ожирением, вызванным диетой. Кишечник (2014) 63: 727–35. DOI: 10.1136 / gutjnl-2012-303839

PubMed Аннотация | CrossRef Полный текст | Google Scholar

49. Лиу А.П., Пазюк М., Лювано Дж. М. мл., Машинени С., Тернбо П. Дж., Каплан Л. М.. Сохраненные сдвиги в микробиоте кишечника из-за обходного желудочного анастомоза снижают вес хозяина и ожирение. Sci Transl Med. (2013) 5: 178ra41. DOI: 10.1126 / scitranslmed.3005687

PubMed Аннотация | CrossRef Полный текст | Google Scholar

50. Renouf M, Hendrich S. Bacteroides uniformis — это предполагаемый вид бактерий, связанный с деградацией изофлавонового генистеина в человеческих фекалиях. J Nutr. (2011) 141: 1120–6. DOI: 10.3945 / jn.111.140988

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Метаболизм холестерина

Метаболизм холестерина

Липидный и липопротеиновый метаболизм (Розенсен, 2009)

Липиды = холестерин и триглицериды — нерастворимы в плазме и переносятся липопротеинами.

Функции = использование энергии, производство стероидных гормонов, производство желчных кислот, отложение липидов.

Липопротеин состоит из этерифицированного и неэтерифицированного холестерина, триглицеридов, фосфолипидов и аполипопротеинов. Белки действуют как кофакторы и лиганды рецепторов.

Основные липопротеины включают:

  1. Хиломикроны — крупные частицы, несущие пищевые липиды
  2. Липопротеины очень низкой плотности — несут эндогенный триглицерид и некоторое количество холестерина
  3. Липопротеины средней плотности — переносят сложные эфиры холестерина и триглицериды
  4. Липопротеины низкой плотности — переносчики эфиров холестерина
  5. Липопротеины высокой плотности — переносчики эфиров холестерина

Экзогенный путь метаболизма липидов:

  1. Пищевой холестерин и жирные кислоты абсорбируются.
  2. Триглицериды образуются в клетках кишечника из свободных жирных кислот, а глицерин и холестерин этерифицируются.
  3. Триглицериды и холестерин объединяются с образованием хиломикронов.
  4. Хиломикроны попадают в кровоток и перемещаются к периферическим участкам.
  5. В периферических тканях свободные жирные кислоты высвобождаются из хиломикронов для использования в качестве энергии, преобразования в триглицериды или хранения в жировой ткани.
  6. Остатки используются при образовании ЛПВП.

Эндогенный путь метаболизма липидов:

  1. VLDL образуется в печени из триглицеридов и сложных эфиров холестерина.
  2. Они могут гидролизоваться липопротеинлипазой с образованием остатков IDL или VLDL.
  3. остатки ЛПОНП выводятся из кровотока или включаются в состав ЛПНП.
  4. частицы ЛПНП содержат ядро ​​из эфиров холестерина и меньшее количество триглицеридов.
  5. ЛПНП усваивается печеночными и непеченочными тканями.
  6. В печени ЛПНП превращается в желчные кислоты и секретируется в кишечник.
  7. В непеченочных тканях ЛПНП используются в производстве гормонов, синтезе клеточных мембран или хранятся.
  8. ЛПНП также поглощается макрофагами и другими клетками, что может привести к избыточному накоплению и образованию пенистых клеток, которые играют важную роль в образовании зубного налета.
Что делает HDL?

HDL представляет собой небольшую частицу, состоящую из фосфолипидов и аполипопротеинов и продуцируемую клетками печени и кишечника.

Чем хорош ЛПВП?

Частота приступов ишемической болезни сердца в нормальной популяции обратно пропорциональна концентрации холестерина ЛПВП в сыворотке крови — низкие уровни несут повышенный риск коронарной болезни

Считается, что

HDL обладают антиатерогенным действием, а высокие уровни HDL обладают кардиозащитным действием.

Этот эффект может быть опосредован обратным транспортом холестерина, процессом, посредством которого избыток холестерина в клетках и атеросклеротических бляшках удаляется и транспортируется обратно в печень.

Риск инфаркта миокарда увеличивается примерно на 25 процентов на каждые 5 мг / дл снижения уровня холестерина ЛПВП в сыворотке ниже средних значений для мужчин и женщин.

Низкий уровень холестерина ЛПВП — компонент метаболического синдрома, который характеризуется ожирением, инсулинорезистентностью, дислипидемией и гипертонией

Пациенты с высоким риском сердечно-сосудистых заболеваний на основании уровней ЛПВП включают:

  • Пациенты с ЛПВП менее 40 мг / дл
  • Пациенты с метаболическим синдромом — уровни HDL-холестерина менее 40 мг / дл у мужчин и 50 мг / дл у женщин.

Физические упражнения, потеря веса (у лиц с избыточным весом), отказ от курения и изменения в диете (в частности, замена мононенасыщенных жирных кислот на насыщенные жирные кислоты) — все это может повысить уровень холестерина ЛПВП.

Лечение низкого уровня ЛПВП включает ниацин и фибраты.

Пара пробиотиков может улучшить липидный обмен: данные человека

Двенадцать недель приема пары пробиотиков привели к снижению уровня триглицеридов на 18% у людей, не страдающих диабетом, с легкой и умеренной гипертриглицеридемией.Считается, что повышенные уровни триглицеридов являются значимым и независимым фактором риска ишемической болезни сердца (ИБС).

Пробиотический режим также был связан со значительным повышением уровня аполипопротеина A-V в плазме (апоА-V), значительного модулятора триглицеридов. Пробиотики также увеличивали размер частиц ЛПНП, при этом более крупные частицы холестерина ЛПНП, по сообщениям некоторых ученых, лучше, чем более мелкие частицы ЛПНП.

Ученые из Университета Йонсей и Korea Yakult Co.сообщают о своих выводах в Atherosclerosis.

Детали исследования

Корейские исследователи 128 человек с гипертриглицеридемией приняли участие в рандомизированном двойном слепом плацебо-контролируемом исследовании. Участники были случайным образом распределены для приема либо порошкообразной добавки, содержащей комбинацию пробиотиков, обеспечивающую 5 миллиардов КОЕ в день каждого штамма, либо плацебо в течение 12 недель.

Результаты показали, что, помимо 18% снижения уровней триглицеридов, уровни ApoA-V увеличились на 21% в группе пробиотиков, в то время как размер частиц ЛПНП увеличился в среднем на 15.6%.

«Самый сильный эффект [был] наблюдался у субъектов с самым высоким уровнем триглицеридов натощак», — добавили исследователи .

Дополнительный генетический анализ участников показал, что на изменения уровней триглицеридов и ApoA-V не влияет генотип APOA5 -1131T> C, что ставит под сомнение другие наблюдения, что носители аллеля C (TC или CC) имели более высокие уровни триглицеридов. чем не перевозчики (TT).

«Механизм, лежащий в основе модуляции липидных профилей сыворотки пробиотиками, остается в значительной степени неясным», — пишет исследователям. «Значительное повышение, которое мы наблюдали в плазме уровней апо AV в группе пробиотиков, может быть результатом активации апо AV или тесной связи между циркулирующим триглицеридом и апо AV, который секретируется в основном из печени с HDL и связан с ЛПОНП.

«Важность апо A-V в регуляции липолиза уровней триглицеридов в плазме через его прямое взаимодействие с липопротеинлипазой была обнаружена [в других исследованиях]. Этот предыдущий результат может объяснить отрицательную корреляцию между изменениями уровня триглицерида в сыворотке крови и изменениями свободных жирных кислот и апо A-V, а также положительную корреляцию между изменениями апо A-V и свободных жирных кислот в группе пробиотиков этого исследования.»

Источник: Атеросклероз
Том 241, выпуск 2, страницы 649-656, doi: 10.1016 / j.atherosclerosis.2015.06.030
« Добавление двух пробиотических штаммов, Lactobacillus curvatus и Lactobacillus plantarum KY1032, снижает уровень триглицеридов натощак и повышает уровни аполипопротеина AV у недиабетических субъектов с гипертриглицеридемией »
Авторы: HY Ан, М. Ким, J.S. Чэ, И-Т. Ан, JH. Сим, И-Д. Чой, S.H.Ли, Дж. Х. Ли

нарушение обмена веществ | Определение, происхождение, типы и факты

Болезнь обмена веществ , любое заболевание или расстройство, нарушающее нормальный метаболизм, процесс преобразования пищи в энергию на клеточном уровне. Тысячи ферментов, участвующих во множестве взаимозависимых метаболических путей, осуществляют этот процесс. Метаболические заболевания влияют на способность клетки выполнять важные биохимические реакции, которые включают переработку или транспортировку белков (аминокислот), углеводов (сахаров и крахмалов) или липидов (жирных кислот).

Британская викторина

44 вопроса из самых популярных викторин «Британника» о здоровье и медицине

Что вы знаете об анатомии человека? Как насчет медицинских условий? Мозг? Вам нужно будет много знать, чтобы ответить на 44 самых сложных вопроса из самых популярных викторин Britannica о здоровье и медицине.

Болезни обмена веществ обычно передаются по наследству, но большинство людей, страдающих от них, могут выглядеть здоровыми в течение нескольких дней, месяцев или даже лет. Симптомы обычно появляются, когда метаболизм в организме подвергается стрессу, например, после длительного голодания или во время лихорадочного заболевания. При некоторых нарушениях обмена веществ можно пройти пренатальный диагностический скрининг. Такой анализ обычно предлагается семьям, у которых ранее был ребенок с нарушением обмена веществ или которые принадлежат к определенной этнической группе.Например, тестирование на болезнь Тея-Сакса относительно распространено среди еврейского населения ашкенази. Страны, которые проводят скрининг на метаболические заболевания при рождении, обычно проверяют до 10 различных состояний. Тандемная масс-спектрометрия — это новая технология, которая позволяет обнаруживать несколько аномальных метаболитов почти одновременно, что позволяет добавить около 30 расстройств к списку состояний, на которые могут быть проверены новорожденные. Если известно, что у ребенка нарушение обмена веществ вскоре после рождения, соответствующую терапию можно начать раньше, что может улучшить прогноз.Некоторые нарушения обмена веществ очень хорошо поддаются лечению, если лечение начато в раннем возрасте. Однако другие не имеют эффективной терапии и вызывают серьезные проблемы, несмотря на раннюю диагностику. В будущем генная терапия может оказаться успешной в лечении некоторых из этих заболеваний.

Заболевания обмена веществ довольно редки по отдельности, но относительно часто, если рассматривать их в группе. Частота конкретных метаболических нарушений варьируется от примерно 1 на 500 (или даже выше в изолированных популяциях) до менее 1 на 1000000.Подсчитано, что метаболические нарушения затрагивают примерно 1 из 1000 человек.

Истоки нарушения обмена веществ

Метаболические пути

В 1908 году британский врач сэр Арчибальд Гаррод предположил, что четыре унаследованных состояния на протяжении всей жизни — алкаптонурия, пентозурия, альбинизм и цистинурия — были вызваны дефектами определенных биохимических путей из-за пониженной активности или полного отсутствия данного фермента. Он назвал эти нарушения «врожденными нарушениями обмена веществ».Хотя Гаррод ошибся в категоризации цистинурии, его идеи дали биохимической генетике прочную основу, и список унаследованных врожденных ошибок метаболизма быстро увеличивался. Эта статья в первую очередь касается этих наследственных метаболических заболеваний, хотя другие нарушения, включая эндокринные заболевания (например, сахарный диабет и гипотиреоз) и недоедание (например, маразм и квашиоркор), также влияют на клеточный метаболизм.

Оформите подписку Britannica Premium и получите доступ к эксклюзивному контенту.Подпишись сейчас

Пища расщепляется клеточными ферментами (белками, которые катализируют превращение соединений, называемых субстратами) в несколько этапов в продукты с другой биохимической структурой. Затем эти продукты становятся субстратом для следующего фермента в метаболическом пути. Если фермент отсутствует или имеет пониженную активность, путь блокируется, и образование конечного продукта оказывается недостаточным, что приводит к заболеванию. Низкая активность фермента может привести к последующему накоплению субстрата фермента, который может быть токсичным при высоких уровнях.Кроме того, незначительные метаболические пути, которые обычно бездействуют, могут активироваться при накоплении субстрата, возможно, с образованием атипичных, потенциально токсичных продуктов. Каждая клетка в организме содержит тысячи метаболических путей, все из которых в той или иной степени взаимосвязаны, так что единичная блокада может повлиять на множество биохимических процессов.

Последствия метаболического дисбаланса могут быть серьезными; умственная отсталость, судороги, снижение мышечного тонуса, органная недостаточность, слепота и глухота могут возникнуть, в зависимости от того, какой фермент дисфункциональный.В последние годы стало очевидно, что даже некоторые состояния, связанные с множественными врожденными аномалиями (например, синдром Смита-Лемли-Опица), имеют метаболическую причину.

Пробиотики и пребиотики в липидном обмене

В настоящее время большинство потребителей осознают тесную взаимосвязь между диетой и здоровьем. Хотя основная роль диеты заключается в обеспечении питательными веществами, продукты больше не рассматриваются только с точки зрения вкуса и потребностей в питании. Использование продуктов питания для улучшения здоровья становится все более популярной идеей.Всемирная организация здравоохранения (ВОЗ) отметила, что нездоровые диеты, например, с высоким содержанием жира, соли и свободного сахара и низким содержанием сложных углеводов, фруктов и овощей, приводят к повышенному риску сердечно-сосудистых заболеваний (ВОЗ, 2003). Липиды играют важную роль в организме человека, и нарушения липидного обмена могут вызывать серьезные нарушения, такие как ожирение, диабет и т. Д. Более недавние открытия показывают, что повышенные уровни триглицеридов натощак связаны с повышенным риском сердечно-сосудистых заболеваний.ВОЗ прогнозирует, что к 2030 году сердечно-сосудистые заболевания останутся ведущими причинами смерти, от которых страдают примерно 23,6 миллиона человек во всем мире (ВОЗ, 2009). В связи с этим существует большой интерес к диетическому регулированию уровней триглицеридов. Для этой цели в основном используется медикаментозная терапия, но большинство людей страдают от нежелательных побочных эффектов такого лечения. Современные диетические стратегии профилактики сердечно-сосудистых заболеваний включают диету с низким содержанием жиров и насыщенных жиров (Taylor and Williams 1998).Хотя такие диеты являются эффективным лечением, их трудно поддерживать в течение длительного времени, и их эффективность со временем снижается (Pereira and Gibson 2002). Растет интерес к альтернативным средствам, обладающим профилактическим и терапевтическим потенциалом. В эту категорию попадают продукты с пробиотиками и пребиотиками. Пробиотики — это живые микроорганизмы, которые приносят пользу для здоровья при употреблении, а пребиотики — это неперевариваемые пищевые ингредиенты, которые выборочно стимулируют рост полезных микроорганизмов в желудочно-кишечном тракте.Пробиотики и / или пребиотики можно использовать в качестве альтернативных добавок для улучшения здоровья. Прошлые исследования in vivo показали, что введение пробиотиков и / или пребиотиков эффективно для улучшения липидных профилей, включая снижение общего холестерина в сыворотке / плазме, холестерина ЛПНП и триглицеридов или увеличение холестерина ЛПВП. Однако другие прошлые исследования также показали, что пробиотики и пребиотики незначительно влияют на липидный профиль (Ooi and Liong 2010). До сих пор неясно, какие механизмы используются пробиотиками или пребиотиками для улучшения липидного обмена.В настоящее время объединение пробиотиков и пребиотиков в «синбиотики» — это новый подход к дальнейшему усилению их эффектов.

Лираглутид улучшает метаболизм липидов за счет увеличения оттока холестерина, связанного с путями ABCA1 и ERK1 / 2 | Сердечно-сосудистая диабетология

Материалы

Самцы мышей db / db (n = 48, возраст 5 недель, BKS-Leprem2Cd479 / Nju, Leprdb mut / mut) и самцы мышей C57BL / 6J (n = 12, возраст 5 недель, Leprdb wt / wt) были приобретены в Исследовательском центре на модельных животных Нанкинского университета.Лираглутид был приобретен в Ново Нордиск, Багсверд, Дания. Клеточная линия гепатомы человека, HepG2, полученная от Cell Resource Center, IBMS, CAMS / PUMC (Пекин, Китай), U0126 (ингибитор ERK1 / 2) была приобретена у Cell Signaling Technology (Беверли, Массачусетс). Антитела против ABCA1, Anti-ABCG1, Anti-SR-B1 и GAPDH были получены от Abcam (Кембридж, Великобритания). Антитела против фосфо-ERK1 / 2, общая ERK1 / 2, были приобретены в Cell Signaling Technology (Беверли, Массачусетс).

Обработка животных

Всех животных содержали в кондиционируемой среде с контролируемой температурой 22 ± 2 ° C и относительной влажностью 50–60% при 12-часовом сдвиге цикла свет-темнота.После периода адаптации в 1 неделю все мыши были случайным образом разделены на пять групп: дикий тип + нормальная диета (WT + ND, n = 12), db / db + ND (n = 12), db / db + High- жирная диета (HFD, n = 12), db / db + HFD + лираглутид (LIRA, n = 12) и db / db + HFD + аторвастатин (AT) (n = 12). Мышам вводили либо лираглутид (200 мкг / кг), либо эквиолюминальный 0,9% физиологический раствор подкожно два раза в день в течение 8 недель. Диабетическим мышам, получавшим HFD, перорально вводили аторвастатин (20 мг / кг / день) в течение 8 недель в качестве группы положительного контроля.В течение этого периода массу тела определяли еженедельно, а уровень глюкозы в крови натощак измеряли каждые 4 недели. После 8-недельного лечения мышей умерщвляли с использованием 1% пентобарбитала натрия (50 мг / кг) после 4-часового голодания. Глазные яблоки были удалены, и были взяты образцы крови. Последующую сыворотку использовали для определения липидных параметров крови. Печень промывали ледяным физиологическим раствором для дальнейшего анализа. Все эксперименты были одобрены этическим комитетом по уходу за животными и исследованиям в больнице Фувай (Пекин, Китай).

Анализ липидов

В соответствии с инструкциями производителя сыворотку готовили из каждого образца крови центрифугированием при 3500 об / мин в течение 10 мин. Общий холестерин сыворотки (TC), глюкоза в крови, триглицериды (TG), холестерин липопротеинов низкой плотности (LDL-C) и холестерин липопротеинов высокой плотности (HDL-C) исследовались автоматическим биохимическим анализатором (Hitachi 917, Tokyo, Japan).

Окрашивание гематоксилин-эозином (HE)

Образцы печени мышей обрабатывали в соответствии со стандартной техникой окрашивания HE [24].Вкратце, ткани печени фиксировали 10% нейтральным формалином, обезвоживали в этаноле и затем заливали. Затем срезы печени (4 мкм) окрашивали НЕ на предмет патологических изменений под оптическим микроскопом.

Окрашивание масляным красным О

Ткани печени мыши немедленно замораживали в жидком азоте и помещали в состав для заливки криостата OCT (Tissue-Tek, Торранс, Калифорния, США). Замороженные срезы печени (8 мкм) окрашивали масляным красным О согласно предыдущему сообщению [25], а внутриклеточные липидные капли наблюдали и оценивали с помощью микроскопии в светлом поле (Leica, Wetzlar, Германия).

Исследование обратного транспорта холестерина in vivo

Клетки Raw264.7 (лейкозные клетки в макрофагах мыши) были получены из Американской коллекции типовых культур (ATCC; Manassas, VA) и выращены в DMEM с добавлением 10% фетальной бычьей сыворотки. РКИ оценивали in vivo путем внутрибрюшинной инъекции клеток RAW264.7, которые были радиоактивно мечены 3 H-холестерином в соответствии с инструкциями производителя, как описано ранее [26]. Вкратце, клетки Raw264.7 радиоактивно метили 5 Ки / мл 3 H-холестерина и холестерина, обогащенного 100 мкг / мл ацетилированного ЛПНП в течение 48 часов.Эти пенистые клетки дважды промывали, уравновешивали в среде с 0,2% бычьим сывороточным альбумином в течение 6 часов, центрифугировали и ресуспендировали в 0,5 мл среды. Для оценки роли лираглутида в стимулировании оттока холестерина из макрофагов в плазму и фекалии, мышам внутрибрюшинно вводили нагруженные холестерином и 3 H-меченые raw264.7 клетки и появление 3 H-холестерина в мышах. плазму и кал в течение 24 ч определяли количественно для жидкостного сцинтилляционного счета.

Анализ жизнеспособности клеток

Набор для подсчета клеток-8 (Dojindo Molecular Technologies, Inc.Кумамото, Япония) использовали для оценки жизнеспособности клеток. Этот анализ оценивали путем культивирования клеток HepG2 в 96-луночных планшетах в течение 24 часов. Затем клетки подвергали воздействию различных концентраций глюкозы (0, 5, 25, 50 и 75 ммоль / л) и лираглутида (0, 10, 100, 1000 и 2000 нмоль / л) в течение 24 часов. После замены среды DMEM в каждую лунку добавляли 10 мкл реагента CCK-8, и 96-луночный планшет инкубировали в темноте при 37 ° C в течение 2 часов. Поглощение измеряли при 450 нм в считывающем устройстве для микропланшетов. Все эксперименты повторяли трижды.

BODIPY-анализ оттока холестерина

BODIPY-отток холестерина определяли, как описано ранее [27]. Вкратце, исходный раствор холестерина BODIPY готовили при 5 мМ в ДМСО. Клетки HepG2 загружали 2,5 мМ BODIPY-холестерина в культуральной среде в течение 2 часов при 37 ° C. Клетки дважды промывали физиологическим буфером (140 мМ NaCl, 5 мМ KCl, 1 мМ CaCl2, 1 мМ MgSO4, 5 мМ глюкозы, 20 мМ HEPES, pH 7,4) и инкубировали с тем же буфером в течение 1 ч при 37 ° C с тряска при 50 об / мин.Клеточный супернатант центрифугировали в течение 5 мин при 6800 g , и интенсивность флуоресценции BODIPY в супернатантах измеряли с использованием считывающего устройства для микропланшетов TECAN Genios Pro (Tecan US, Inc., Моррисвилл, Северная Каролина, США) при возбуждении 490 ± 10 нм и эмиссия 535 ± 20 нм.

Количественная ПЦР в реальном времени (qRT-PCR).

SYBR green Количественная полимеразная цепная реакция в реальном времени (qRT-PCR) была использована для определения уровней мРНК ABCA1, ABCG1, SR-B1. Реагент Trizol (Invitrogen, Waltham, USA) использовали для экстракции общей РНК из ткани печени мыши и клеток HepG2 в соответствии с инструкциями производителя, и качество экстрагированной РНК измеряли по поглощению от 260 до 280 нм.Затем кДНК получали обратной транскрипцией (ОТ) с использованием HifAir ™ II 1st Strand cDNA Synthesis SuperMix для кПЦР (YEASEN, Шанхай, Китай). Амплификацию конкретных генов проводили с использованием смеси Hieff ™ qPCR SYBR ® Green Master Mix (YEASEN, Шанхай, Китай), а затем анализировали относительные уровни экспрессии с помощью системы ПЦР в реальном времени ABI7500 (Applied Biosystems). Глицеральдегид-3-фосфатдегидрогеназа (GAPDH), эндогенный ген домашнего хозяйства, использовали для нормализации экспрессии.Специфические праймеры RT и праймеры для ПЦР следующие: ABCA1 (прямой 5′-ACCCACCCTATGAACAACATGA-3 ‘и обратный 5′-GAGTCGGGTAACGGAAACAGG-3′), ABCG1 (прямой 5’-GGGGTCGCTCCATCATTATTG-3 ‘и обратный 5GTAC-TTCCAC ‘), SR-B1 (прямая 5′-CCTATCCCCTTCTATCTCTCCG-3′ и обратная 5’-GGATGTTGGGCATGACGATGT-3 ‘) и глицеральдегид-3-фосфатдегидрогеназа (GAPDH, прямая 5’-GGGCGAGATCCCTGATCGATCGATTCGATTCGATTCGATTCGATTCGATTCGATTCGATTCGATTCGATTCGATTCGATTCGATTCGATTC 3 ′). Каждую реакцию проводили в трех экземплярах, и результаты qRT-PCR были рассчитаны с использованием предыдущего метода [28].

Вестерн-блоттинг

Образцы ткани печени мыши и клеток HepG2 гомогенизировали на льду в буфере для лизиса [20 мМ Трис-HCl, pH 7,5, 150 мМ NaCl, 1 мМ ЭДТА, 1 мМ ЭГТА, 1% Тритон X-100, 50 мМ дитиотреитол, полный коктейль ингибиторов протеазы (Roche Diagnostics) и коктейль ингибиторов фосфатазы I и II (Sigma-Aldrich)]. Затем гомогенат центрифугировали при 12000 g в течение 15 минут и собирали супернатант. Концентрации белка определяли с использованием набора для анализа белков BCA (Beijing Kangwei Century Biotechnology Co, Ltd, Пекин, Китай).Впоследствии 35 мкг белка из отдельных образцов разделяли с помощью предварительно подготовленных гелей NuPAGE Novex 4–12% (мас. / Об.) Бис-Трис (Life technologies, Carls-bad, CA, USA), а затем переносили на нитроцеллюлозную мембрану с использованием система сухого блоттинга iBlotTM, описанная производителем (Invitrogen, Carlsbad, CA, USA). Мембраны блокировали в буфере TBST (20 мМ Трис, pH 7,5, 150 мМ NaCl, 0,1% твин-20), содержащем 5% обезжиренного молока, в течение 2 часов при комнатной температуре, а затем инкубировали в течение ночи при 4 ° C. Анти-ABCA1, Анти-ABCG1 или Anti-SR-B1.После этого мембраны инкубировали со вторичными антителами, включая козий анти-кроличий IgG / пероксидазу хрена (HRP) и козий антимышиный IgG / HRP (Abcam), в течение 2 часов при комнатной температуре.




Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *