Содержание

Как кишечная микрофлора договаривается с иммунной системой

Незрелые Т-лимфоциты направляются на курсы повышения квалификации в кишечник, где учатся распозновать дружелюбную микрофлору и не атаковать ее без надобности.
Необходимое свойство иммунитета — его способность отличать своих от чужих. Между тем в нашем кишечнике живет великое множество бактерий, атаковать которые никак нельзя, хотя формально они относятся к классу врагов. Как именно клетки имунной системы обучаются распознавать кишечную микрофлору? К примеру, считается, что недуги вроде язвенного колита и болезни Крона возникают из-за того, что иммунитет вдруг начинает нападать на собственную кишечную микрофлору человека.

Загадкой в данном случае является то, что распознавать своих иммунные клетки учатся в тимусе. Незрелые Т-лимфоциты синтезируют великое множество мембранных рецепторов, которые позволяют им узнавать самые разные поверхностные белки-антигены. В тимусе Т-лимфоцитам предъявляются специфичные антигены, которые сидят на поверхности собственных клеток организма. Т-лимфоциты, узнающие своих, либо уничтожаются, либо становятся Т-регуляторами. Функция регуляторов в том, чтобы подавлять аутоиммунный ответ, не давая иммунитету «поедать» своего же хозяина. Но при этом никаких представителей кишечной микрофлоры в тимусе нет и в помине. Как же тогда иммунитет учится узнавать кишечные бактерии?

Исследователи из Вашингтонского университета в Сент-Луисе (США) опубликовали в журнале Nature статью, в которой утверждают, что открыли еще одну обучающую базу для имунных клеток. Уже появлялись предположения, что предшественники Т-лимфоцитов могут дозревать где-то еще, помимо тимуса, но сейчас впервые было получено строгое экспериментальное подтверждение. Ученые обнаружили, что рецепторы на поверхности Т-регуляторов, обитающих в желудочно-кишечном тракте мышей, отличаются от рецепторов их «коллег» из других тканей того же организма. Было решено проверить, не является ли это следствием контакта незрелых Т-лимфоцитов с микробными обитателями кишечника.

Гены, которые кодировали эти рецепторы, были пересажены в клетки костного мозга (где берут начало иммунные клетки). Операция проводилась над мышами, которые были генетически лишены спсобности создавать какие-либо собственные Т-клетки.
Костный мозг таких животных с двумя пересаженными генами начинал производить предшественников Т-клеток, но созреть им не удавалось. Если же мышей, из клеток которых взяли эти гены, и тех, которым эти гены пересадили, держали вместе, то у мышей-доноров появлялись такие же Т-регуляторы. Это происходило из-за того, что у животных «обобществлялась» кишечная микрофлора, бактерии от первых попадали в организм вторых. Иными словами, бактерии обучали незрелые Т-клетки не атаковать их, и присходило это в кишечнике.

Как именно контактируют незрелые Т-клетки и кишечная микрофлора, пока неизвестно, но ученые не сомневаются, что причиной многих кишечных болезней может быть именно нарушение процесса натаскивания иммунных клеток в кишечнике. Если научиться искуственно «разъяснять» иммуным клеткам, что есть бактериальные антигены, то можно будет предотращать нежелательные иммунные атаки на кишечных симбионтов.

http://science.compulenta.ru

Микробиота и иммунные клетки на страже кишечника

Распространение COVID-19 продолжается, и мы надеемся, что у нас есть необходимые инструменты, чтобы победить инфекцию. С момента рождения человека его иммунная система выполняет защитные функции в тесном взаимодействии с кишечной микробиотой.

 

Не только коронавирус, но и любой попадающий в организм микроб — бактерия, вирус или грибок — представляет потенциальную опасность. Для удаления микроба из организма активируются защитные функции, тщательную регуляцию которых выполняют иммунные клетки и кишечная микрофлора. Защитный барьер, созданный кишечником, препятствует попаданию инородных тел в кровоток.

Кишечный барьер

Цель взаимодействия иммунной системы и кишечника — обеспечение и поддержание баланса кишечной микрофлоры в течение всей жизни человека. Кишечная микробиота создает защитную основу из микробов, которая препятствует колонизации кишечника патогенными бактериями. Баланс между клетками кишечника и микрофлорой создает условия, благоприятные для развития полезных бактерий. Напротив, любое изменение в этой экосистеме отрицательно влияет на этот баланс. Возникает порочный круг: воспаление способствует колонизации патогенными микроорганизмами, которые в свою очередь усиливают воспаление. Клетки кишечника, в свою очередь, формируют естественный физический барьер, покрытый толстым слоем слизи, который не позволяет бактериям, вирусам и грибам покидать просвет желудочно-кишечного тракта.

Защитные клетки кишечника

Некоторые иммунные клетки, например, макрофаги1, реализуют врожденный иммунитет, который обеспечивает быструю реакцию, но не является специфичным2: «Я тебя вижу, я тебя поймаю, я тебя уничтожу». Остальные клетки, в том числе лимфоциты1, относятся к системе приобретенного иммунитета, который реагирует медленнее. Он обладает специфичностью3 и иммунной памятью о предыдущих инфекциях: «Я тебя узнаю, я тебя поймаю, я тебя уничтожу». Одной из функций клеток приобретенного иммунитета является выработка антител. Точное регулирование иммунной системы предотвращает избыточный воспалительный ответ на полезные бактерии, а также за счет обеспечения толерантности к питательным веществам

4 не допускает развития пищевой аллергии.

Высокосинхронизированная кооперация

Бактерии находятся в постоянном взаимодействии с кишечником, как напрямую, так и за счет передачи сигналов. Полученные сообщения позволяют иммунным клеткам постоянно быть настороже и усиливать кишечный барьер там, где это необходимо. Они также способствуют активации врожденного и приобретенного иммунного ответа. По данным исследований у животных, эти взаимодействия также влияют и на другие органы. Так диета, богатая волокнами, позволяет микробиоте вырабатывать небольшие молекулы, которые оказывают благоприятный эффект на аллергические реакции со стороны легких. И действительно, микробиота может уменьшать избыточное воспаление, происходящее не только в кишечнике, снижая интенсивность и вероятность возникновения инфекции, стресса,

сезонной аллергии или пищевой непереносимости5.

Стимулируем микробиом

Несмотря на то, что исследования взаимосвязи между COVID-19, микробиотой и иммунной системой пока не завершены, оптимальным способом поддержания кишечного барьера является здоровый образ жизни, способствующий сохранению микробиоты — например, за счет сбалансированной диеты.

 

1) Макрофаги и лимфоциты — это лейкоциты, выполняющие функцию иммунных клеток. Они защищают организм за счет удаления проникших в него инородных тел.

2) Неспецифичное действие носит общий характер, оно не направлено против определенных молекул или микробов.

3) Специфичное действие направлено против определенных молекул или микробов.

4) Питательные вещества — это небольшие молекулы, которые высвобождаются в процессе переваривания пищи.

5) Пищевая непереносимость возникает, когда иммунная система неправильно распознает молекулы питательных веществ как вредные вещества.

 

Источники :

Gaboriau-Routhiau, Cerf-Bensussan. Microbiote intestinal et développement du système immunitaire 2016. Med Sci (Paris). 32(11): 961–967. doi: 10.1051/medsci/20163211011.

Caminero A, Meisel M, Jabri B, et al. Mechanisms by which gut microorganisms influence food sensitivities. Nat Rev Gastroenterol Hepatol. 2019;16(1):7‐18. doi:10.1038/s41575-018-0064-z

https://www.futura-sciences.com/sante/questions-reponses/medecine-intestin-role-joue-t-il-immunite-11392/

https://www.futura-sciences.com/sante/actualites/nutrition-diversite-microbiote-favorise-renforcement-systeme-immunitaire-80225/

Взаимосвязь функции местного иммунитета и микробиоценоза кишечника, возможности иммунокоррекции дисбактериоза | #09/09

Желудочно-кишечный тракт (ЖКТ) выполняет не только пищеварительную, но и иммунную функцию, в частности, участвует в реализации защитных реакций организма против патогенных, условно-патогенных микроорганизмов и многих неорганических веществ.

Местный иммунитет кишечника

Около 80% всех иммунокомпетентных клеток организма локализовано именно в слизистой оболочке кишечника; около 25% слизистой оболочки кишечника состоит из иммунологически активной ткани и клеток; каждый метр кишечника содержит около 1010 лимфоцитов [1].

Иммунокомпетентная (лимфоидная) ткань ЖКТ представлена организованными структурами (пейеровы бляшки, аппендикс, миндалины, лимфатические узлы) и отдельными клеточными элементами (интраэпителиальные лимфоциты, плазматические клетки, макрофаги, тучные клетки, гранулоциты). Популяция клеток лимфоидной ткани разнородна и состоит из множества групп, подгрупп и клонов клеток с различными функциональными свойствами и специфичностью рецепторов к антигенам [2, 3].

Эпителий ЖКТ отграничивает ткани макроорганизма от огромного количества живых и неживых антигенов — субстанций, несущих признаки чужеродной генетической информации. Пероральное воздействие антигена (в том числе микробов и их токсинов) обычно создает, с одной стороны, местную «слизистую» IgA-защиту (секреторный иммунитет) и клеточно-опосредованную реакцию, но, с другой стороны, и системную толерантность или гипореактивность — подавление последующей выработки антигеноспецифических антител классов G и М и развития клеточно-опосредованного иммунитета. По отношению к патогенным и условно-патогенным микроорганизмам система местного иммунитета кишечника должна проявить адекватные защитные свойства, а по отношению к нормофлоре — как минимум, толерантность, а в лучшем случае — активно участвовать в процессах адгезии, выживания и размножения представителей нормофлоры.

Специфические иммунные механизмы вырабатываются кишечником для защиты от потенциально опасных микроорганизмов в течение всей жизни. Недифференцированные лимфоциты, продуцирующие в большинстве своем секреторные IgA- или IgM-антитела, присутствуют в собственном слизистом слое или пейеровых бляшках.

Стимуляция В- и Т-лимфоцитов в присутствии чужеродного антигена происходит вслед за их выходом из брыжеечных узлов в грудной проток, кровеносное русло и возвращением в кишечник, где они скапливаются также в собственном слое слизистой оболочки. Активированные клетки продуцируют специфические антитела классов IgА и IgМ, которые секретируются на поверхности слизистой оболочки через 4–8 дней после стимуляции. Иммуноглобулины образуют комплексы с антигенами, нейтрализуют токсины, препятствуют контакту микроорганизмов с клетками-«мишенями» макроорганизма, способствуют быстрому выведению микроорганизмов из ЖКТ благодаря агглютинации.

Главная функция кишечных антител — иммунное отторжение у поверхности слизистой оболочки. Известно, что IgA преобладает среди иммуноглобулинов во всех секретах и в собственной пластинке кишечника. Секреторный IgA, выполняющий роль главного «чистильщика» и иммуномодулятора слизистой оболочки ЖКТ, удерживается около эпителиальных клеток в результате взаимодействия с гликокаликсом, во многом благодаря присутствию нормофлоры. IgA занимает благоприятную позицию, препятствующую поглощению антигенов. Двумерная молекула IgA может функционировать как агглютинин, уменьшая прилипание бактерий к энтероцитам [4].

В слизистой оболочке кишечника есть также клетки, вырабатывающие иммуноглобулины других классов, но их значительно меньше. Так, соотношение плазматических клеток, продуцирующих IgA, IgM, IgG, равно соответственно 20:3:1 [2].

Важнейшее свойство системы местного иммунитета кишечника — феномен рециркуляции лимфоцитов. Сенсибилизированные антигенами (как пищевыми, так и инфекционными) лимфоциты пейеровых бляшек мигрируют в брыжеечные лимфатические узлы, а оттуда по лимфатическим сосудам через грудной проток и систему кровообращения направляются к собственному слою слизистой оболочки кишечника, главным образом в качестве клеток, секретирующих IgA. Этот механизм обеспечивает формирование клонов лимфоцитов и образование специфических антител в участках слизистой оболочки, отдаленных от очага первичной сенсибилизации. В процессе сенсибилизации плазматических клеток с последующим клонированием лимфоцитов, вырабатывающих антитела с определенными свойствами (аналогичными тем, которые выступили матрицей), участвуют не только нативные молекулы иммуноглобулинов, но и активные Fc- и F(ab’)2-фрагменты.

Клеточный иммунитет кишечника в отличие от системы секретируемых им антител изучен недостаточно. Известно, что после перорального воздействия антигенов системные клеточные иммунные реакции выявляются редко. Очевидно, когда здоровые люди получают безвредные антигены (например, антигены нормофлоры), в слизистой оболочке кишечника не развиваются реакции клеточного иммунитета [2].

Система местного иммунитета кишечника работает следующим образом. Попавшие в просвет кишечника или на слизистые оболочки микроорганизмы распознаются иммуноглобулинами памяти (IgG), после чего информация передается в иммунокомпетентные клетки слизистой оболочки, где из сенсибилизированных лимфоцитов клонируются плазматические клетки, ответственные за синтез IgА и IgМ. В результате защитной деятельности этих иммуноглобулинов включаются механизмы иммунореактивности или иммунотолерантности. Иммунная система «запоминает» антигены нормофлоры, чему способствуют генетические факторы, а также антитела класса G, передающиеся от матери плоду во время беременности, и иммуноглобулины, поступающие в ЖКТ ребенка с грудным молоком. В результате рециркуляции лимфоцитов и клонирования иммунный ответ охватывает все слизистые ЖКТ.

Регуляция иммунных реакций слизистой оболочки кишечника представляет собой сложный процесс, который может изменяться в различных ситуациях, таких как: наличие или отсутствие повреждения слизистой оболочки, сохранение целостности и функциональности биопленки, наличие острых или хронических инфекций, зрелость иммунной системы, состояние питания и генетический потенциал индивидуума. В результате повреждения слизистой оболочки могут возникнуть изменения иммунологической реактивности, хотя в этой ситуации трудно различить первичные и вторичные эффекты.

Роль кишечной микрофлоры в иммунных реакциях

Микрофлора кишечника защищает человека от колонизации экзогенными патогенными микроорганизмами и подавляет рост уже имеющихся в кишечнике патогенных микроорганизмов за счет конкуренции за питательные вещества и участки связывания, а также выработки определенных ингибирующих рост патогенов субстанций. Кроме того, бактерии участвуют в реализации иммунологических защитных механизмов [5].

Известно, что одна из функций нормофлоры — иммунотропная, заключающаяся в стимуляции синтеза иммуноглобулинов, потенцировании механизмов неспецифической резистентности, системного и местного иммунитета, пропердина, комплемента, лизоцима, а также в стимуляции созревания системы фагоцитирующих мононуклеаров и лимфоидного аппарата кишечника [6, 7]. Нормофлора активирует не только местный иммунитет кишечника, но и иммунную систему всего организма, что подтверждается в опытах на безмикробных животных [8]. Основные направления деятельности индигенной (нормальной) микрофлоры в обеспечении нормального иммунного ответа: изменение иммуногенности чужеродных белков путем протеолиза; снижение секреции медиаторов воспаления в кишечнике; снижение интестинальной проницаемости; направление антигена к пейеровым бляшкам. Эти же эффекты реализуются в пробиотических препаратах [5].

В кишечнике бактерии являются важнейшей составной частью биопленки: гликокаликс — слизь — IgA — нормофлора. Биопленка покрывает слизистую кишечника изнутри, занимает все выпуклости, образуемые энтероцитами, и защищает слизистую оболочку от дегидратации, физической и химической агрессии, а также от атак микроорганизмов, бактериальных токсинов, паразитов [9].

На фоне снижения бифидо- и лактобактерий повышается проницаемость эпителиального барьера кишечника для макромолекул пищи и дефицит секреторного IgA [10]. В свою очередь, дефицит секреторного IgA может приводить к развитию заболеваний кишечника и к частым синубронхиальным инфекциям, а в конечном итоге — к предрасположенности к атопии и аутоиммунным заболеваниям [11].

Проведенные на животных исследования показали, что при нарушениях биоценоза в ЖКТ развивается аутоиммунизация к комплексному антигену кишечной стенки, а применение иммунобиологических препаратов предотвращает этот процесс [12].

Дисбактериоз как иммунная дисфункция

Иммунная система регулирует баланс биоценоза кишечника, т. е. механизмы саморегуляции нормофлоры контролируются местным иммунитетом кишечника. Поскольку любой микроорганизм является антигеном, должны существовать механизмы отторжения чужеродных микроорганизмов, а также толерантности и создания благоприятных условий для нормофлоры.

Известно, что через плаценту от матери плоду передаются IgG, то есть иммуноглобулины, обеспечивающие иммунологическую память. Антитела классов М и А через плаценту не проходят, что объясняет недостаточную защищенность новорожденного против грамотрицательных микроорганизмов (энтеробактерии, сальмонеллы) [13]. Кроме того, доказано, что первые микроорганизмы, попадающие в кишечник, появляются там в процессе и после рождения ребенка и прикрепляются к определенным рецепторам [14]. Процесс специфической адгезии условно-патогенных и болезнетворных микроорганизмов к слизистой оболочке ЖКТ может блокироваться среди прочих факторов присутствием IgA и лизоцимом, которые, в свою очередь, способствуют адгезии к рецепторам представителей бифидо- и лактофлоры [15].

Подтверждением роли IgA в предотвращении колонизации слизистых оболочек посторонними микроорганизмами является тот факт, что 99% бактерий представителей нормофлоры не покрыты секреторными иммуноглобулинами. Напротив, энтеробактерии, стафилококки, другие условно-патогенные и сапрофитные микроорганизмы полностью покрыты IgA [8]. В основе этого явления лежит феномен иммунологической толерантности к нормофлоре.

У новорожденных и детей раннего возраста транзиторная иммунная недостаточность — биологическая закономерность, в основном относящаяся к гуморальному иммунитету [13]. У детей этой возрастной группы значительно чаще, чем у детей старше года, возникают стойкие нарушения биоценоза кишечника, что отчасти связано с недостаточностью иммунной системы.

Физиологическая недостаточность системы местного иммунитета кишечника в первые три мес жизни ребенка компенсируется поступлением IgA и других защитных факторов с женским молоком. При грудном вскармливании ежесуточно ребенок получает до 1,5 г IgА. У детей, находящихся на искусственном или раннем смешанном вскармливании, т. е. лишенных защитных факторов женского молока, значительно чаще наблюдаются пищевые аллергии и дисбактериозы кишечника, что отмечается большинством исследователей в этой области.

Проникновение инфекционных агентов на слизистые оболочки ЖКТ и других органов вызывает ответную реакцию системы местного иммунитета в виде нарастания концентрации IgA, который вырабатывается при участии нормофлоры. Соответственно, может возникнуть ситуация, когда микробиологический дисбаланс одного типа будет способствовать усугублению микроэкологических нарушений. Так, снижение количества нормофлоры влечет за собой дефицит IgA, в результате чего повышается колонизация слизистых оболочек условно-патогенной флорой (УПФ).

Врожденные и транзиторные аномалии системы местного иммунитета кишечника снижают резистентность организма не столько к агрессивным вирулентным микроорганизмам, сколько к УПФ. С ними связана устойчивость кишечного дисбактериоза [16].

Практически у 100% людей с приобретенными иммунодефицитами (в результате радиационного воздействия и других иммуносупрессорных факторах) имеются нарушения состава кишечной микрофлоры, при этом у них отмечается не только повышенный рост УПФ, но и резкое снижение нормофлоры [8], то есть нарушаются и защитная функция местного иммунитета, и иммунологическая толерантность, что может косвенно свидетельствовать о том, что система местного иммунитета способствует не только элиминации чужеродных микроорганизмов, но и создает оптимальные условия (а не только иммунологическую толерантность) для нормофлоры.

Учитывая значительное взаимодействие между биоценозом кишечника и системой местного иммунитета кишечника, целесообразно считать дисбактериоз не только микробиологической, но и иммунологической проблемой, что должно отражаться в лечебной тактике.

Иммунокоррекция при дисбактериозе кишечника

Развитие дисбактериоза свидетельствует о недостаточности работы системы местного иммунитета кишечника. Полностью поддерживая тезис о вторичности нарушений биоценоза (дисбактериоз всегда вторичен и причинно обусловлен), можно считать, что одной из причин развития любого дисбактериоза является иммунологическая дисфункция и, прежде всего, недостаточность гуморального иммунитета.

У детей первых месяцев жизни транзиторная иммунная недостаточность — это биологическая закономерность, в основном относящаяся к гуморальному иммунитету. Именно поэтому у детей этой возрастной группы значительно чаще, чем у детей старше года, возникают стойкие и транзиторные нарушения биоценоза кишечника без каких-либо других видимых причин. Затем причинами иммунной дисфункции могут быть хронические вялотекущие паразитарные или микробные инфекции, острые кишечные инфекции, острые респираторные заболевания, детские инфекции, вакцинации; неблагоприятные экологические факторы; стрессы; применение антибиотиков и др. Очень часто проявления дисбактериоза отмечаются через некоторое время после перечисленных воздействий.

Основное средство для иммунокоррекции дисбактериоза — комплексный иммуноглобулиновый препарат (КИП), разработанный сотрудниками МНИИЭМ им. Г. Н. Габричевского [17]. Материалом для получения КИП служит донорская плазма от нескольких тысяч доноров, поэтому можно говорить о коллективном иммунитете. КИП, в отличие от нормального иммуноглобулина человека, содержит иммуноглобулины трех классов: 50% IgG, 25% IgM, 25% IgA. КИП характеризуется повышенным содержанием антител к энтеробактериям (шигеллы, сальмонеллы, эшерихии, протей, клебсиелла и др. ), Pseudomonas aeruginosa, стафилококкам, а также к ротавирусам. Таким образом, в состав КИП входят иммуноглобулины 3 классов к основным видам патогенной и условно-патогенной флоры. Специфические антитела, содержащиеся в КИП, нейтрализуют действие энтеропатогенных микроорганизмов, что достигается наличием в препарате антител одинаковой специфичности, но разных классов, способствующих агглютинации, нейтрализации и преципитации инфекционных агентов.

Препарат представляет собой лиофилизированную смесь во флаконах. 1 стандартная доза содержит 300 мг белка и следовые количества консервантов. Введенный через рот, КИП частично расщепляется в желудке и двенадцатиперстной кишке на активные составляющие: Fc- и F(ab’)2-фрагменты, которые сохраняют серологическую и антигенсвязывающую активность иммуноглобулинов [18]. Эти фрагменты имеют слишком большую молекулярную массу, чтобы проникнуть в системный кровоток через слизистую оболочку кишечника, поэтому КИП оказывает в основном местное действие в просвете, на слизистых оболочках и в собственном слое слизистой оболочки, проникая в кровоток в микроколичествах путем пиноцитоза и т. п. Действие КИП происходит на протяжении всего ЖКТ, но особенно в толстом кишечнике, где сосредоточено большое количество лимфоидной ткани (пейеровы бляшки).

Чтобы понять механизм действия КИП, следует вспомнить основные положения классической иммунологии [13, 16]. Известно, что наиболее представленные в сыворотке крови любого человека IgG (75%) имеют самую простую среди антител структуру и являются основными носителями иммунологической памяти. Специфические моноклональные иммуноглобулины образуются в лимфоидной ткани, их синтезируют лимфоциты, прошедшие дифференцировку за счет сенсибилизированных антигеном антител. Несмотря на короткий срок жизни иммуноглобулинов класса G (21–28 дней), за счет дифференцировки лимфоцитов иммунологическая память сохраняется достаточно долго (часто пожизненно). Молекулы иммуноглобулинов у всех людей имеют сходную структуру (например, IgG к клебсиеллам одинаков у всех), поэтому не воспринимаются иммунной системой как чужеродные белки. Введенные в организм «чужие» антитела, достигнув лимфоидной ткани кишечника, включаются в формирование иммунологической памяти наряду с собственными, которые вырабатываются в результате контакта с антигеном. Феномен рециркуляции лимфоцитов способствует образованию специфических антител в участках слизистой оболочки, отдаленных от очага первичной сенсибилизации. Поэтому иммуноглобулины, введенные энтерально, не только выполняют функцию иммунного ответа в кишечнике, но и выступают в роли матрицы, с которой клонируются плазматические клетки с заданными свойствами. Система местного иммунитета кишечника приобретает способность противостоять тем микроорганизмам, антитела к которым содержатся в КИП. Пассивная иммунизация ребенка, получающего материнское молоко, осуществляется аналогично через иммуноглобулины, содержащиеся в нем. Таким образом, иммунокоррекция комплексным иммуноглобулиновым препаратом физиологична. КИП стимулирует механизмы развития собственного местного гуморального иммунитета, что особенно важно для детей, лишенных материнского молока.

Кроме действия на иммунитет кишечника, КИП обладает прямым антимикробным действием за счет содержания в нем антител классов М и А. Эти иммуноглобулины, связываясь с комплементом, вызывают лизис бактерий. Поэтому КИП может использоваться без добавления других антибактериальных препаратов [19].

Для коррекции микробиологических нарушений КИП назначают курсом 5–10 дней по 1 дозе 1 раз в сутки (утром за 30 мин до еды). Пятидневный курс рекомендован при следующих типах дисбактериоза:

  • дисбактериоз с отсутствием в исследовании УПФ компенсированный;

  • дисбактериоз с количеством УПФ ≤ 50%;

Пролонгированные курсы КИП (десятидневный или два пятидневных курса с интервалом между ними 5 дней — схема 5+5) показаны:

Пролонгированные курсы при описанных ситуациях оказались эффективнее традиционного пятидневного курса, что подтвердило специальное исследование [20].

Кроме КИП во флаконах существуют свечные формы, а также комбинации КИП с интерфероном (Кипферон). Кипферон в свечах обладает местным действием в дистальных отделах прямой кишки и общим иммуностимулирующим действием за счет всасывания в геморроидальном сплетении прямой кишки (система нижней полой вены).

КИП в свечах используется у детей со следующими показаниями: запоры, сопровождающиеся развитием трещин прямой кишки; симптомы колита; профилактика и лечение респираторных инфекций у детей старше 1 года; а также совместно с КИП во флаконах, применяемым per os, для усиления иммуностимулирующего действия у детей с выраженным ослаблением иммунитета.

Курс лечения КИП в свечах составляет 5–10 дней, по 1/2–1 свече однократно на ночь, после опорожнения кишечника. Улучшение самочувствия ребенка наступает в процессе лечения или по окончании курса. Эффект применения КИП в свечах подтверждается лабораторными исследованиями.

Кроме коррекции дисбактериоза КИП используют в сочетании с традиционной этиотропной и патогенетической терапией для лечения острых кишечных инфекций установленной или неясной этиологии, особенно у детей раннего возраста [21, 22]. У больных на 2–3 день уменьшается интоксикация, снижается кратность стула, улучшается его консистенция, исчезают патологические примеси, а на 5–6 день наступает нормализация стула. Исследование микрофлоры кишечника показывает санацию организма от возбудителя, при этом, в отличие от использования антибиотиков, уменьшения количества нормофлоры не наблюдается. Свечи с КИП показаны для лечения острых кишечных инфекций у выборочного контингента детей (при рвоте, непереносимости орального введения и т. д.).

Безопасность использования КИП

КИП с осторожностью следует применять у детей с аллергией на белок, реакцией на введение иммуноглобулинов в анамнезе, а также при других ситуациях, чреватых развитием побочных реакций при использовании, и противопоказаниях к применению иммуноглобулинов.

Технология получения КИП, включающая спиртовое фракционирование сыворотки с последующим осаждением фракции иммуноглобулинов полиэтиленгликолем, исключает возможность передачи с препаратом вирусов гепатита В, ВИЧ и других патогенных микроорганизмов. Кроме того, донорская или плацентарная кровь, из которых получают плазму для приготовления КИП, а также серии готового препарата тщательно проверяют. Поэтому опасения инфицирования посредством приема КИП не обоснованы [23].

Клинически выраженные аллергические реакции при приеме КИП наблюдались крайне редко. В некоторых случаях (особенно при совместном использовании с бактериофагами) отмечалось кратковременное ухудшение самочувствия, усиление имевшихся до начала лечения симптомов, что, по-видимому, связано с лизисом УПФ. У некоторых детей на фоне приема КИП снижался аппетит, но восстанавливался всегда быстро и самостоятельно.

Использование КИП пролонгированными курсами не увеличило частоту побочных эффектов по сравнению с традиционными схемами. Для подстраховки в отдельных случаях одновременно с приемом КИП можно назначать антигистаминные препараты.

По вопросам литературы обращайтесь в редакцию.

Ю. А. Копанев, кандидат медицинских наук НИИ эпидемиологии и микробиологии им. Г. Н. Габричевского, Москва

Как микрофлора кишечника связана с иммунитетом

Малейший сквозняк — и вы опять простыли? Не расстраивайтесь, сегодня мы с вами, дорогие друзья, попытаемся обнаружить причины нашего ослабленного иммунитета в самых неожиданных местах. А также узнаем о том, как природными способами восстановить микрофлору кишечника, а значит, укрепить иммунитет и здоровье в целом.

Как-то непривычно связывать бесконечные сопли и кашель с запором, поносом или бурчанием в животе. Но медики категоричны: подверженность простудным заболеваниям часто является реакцией организма на состояние кишечника.

Дело в том, что микрофлора ЖКТ (желудочно-кишечного тракта) — очень важная часть иммунной системы человека. Чем хуже себя чувствуют жизненноважные бактерии и микроорганизмы, обитающие в кишечнике, и чем их меньше, тем больше проблем в туалете и ниже иммунитет.

Около 70% иммуномодулирующих клеток человека находится в желудочно-кишечном тракте. Это значит, что наше здоровье в сезон простуд во многом зависит от благополучия ЖКТ.

Факторы, подавляющие иммунитет и уничтожающие микрофлору

Факторы, влияющие на состояние микрофлоры Dicorosy.com

В былые времена, когда трава была зеленее, воздух «вкуснее» и пища здоровее, микрофлора кишечника сама регулировала свой баланс, поддерживая иммунные силы организма. Но пришел прогресс, и иммунитет ухнул вниз. Во многом по той причине, что прогресс плохо сказался на микрофлоре кишечника. Вот лишь несколько причин, от которых весьма нехорошо пищеварительным бактериям:

  • Антибиотики. Сильные лекарства, борясь с инфекциями, заодно уничтожают и полезных обитателей кишечника. К слову, антибиотики могут поступать в организм не только со всевозможными медикаментами. Их довольно часто используют в животноводстве, а потому с огромной вероятностью антибиотики могут содержаться даже в мясе и рыбе.
  • Сырая вода из-под крана. Точнее, входящие в ее состав хлор и фтор, которые буквально выжигают микрофлору. Чтобы получить дозу «разрушителей», воду даже не нужно пить, достаточно залить ее в увлажнитель воздуха. Тем не менее, вода просто необходима для нашего организма, но надо знать какая именно вода. Об этом можно прочесть в статье «Вода полезнее витаминов!»
  • Выхлопные газы и плохое экологическое состояние в целом.
  • Хронические стрессы.

Симптомами неполадок в кишечники могут быть не только запор, метеоризм или бесконечные простуды. Нарушения полноценной жизнедеятельности микрофлоры проявляют себя пищевыми аллергиями, экземой, прыщиками и угрями, от которых невозможно избавиться, герпесом, кандидозом (молочницей), болезнями суставов.

Обнаружив у себя одну из этих проблем, многие подсаживаются на мази и лекарства, борясь с симптомами, но не с первопричиной. Хотя есть значительный шанс, что разрешить ситуации можно всего лишь откорректировав питание.

Природное восстановление микрофлоры кишечника

Самый простой способ поддержать ослабленную микрофлору кишечника —подселить к ней новых «жильцов» — полезные бактерии пробиотики. Больше всего их содержится в кисломолочных продуктах (кефир, питьевой йогурт, простокваша, сыр мацони) и квашеной капусте. В отличие от квашеной капусты, которую желательно квасить самостоятельно и употреблять в любых количествах, кисломолочные продукты следует тщательно выбирать и обращать пристальное внимание на состав. Кроме того, употребление их два-четыре раза в неделю будет вполне достаточно, поскольку не очень желательно сильно на них подсаживаться.

Кроме того, богат пробиотиками хлеб на закваске (лучше всего приготовить самостоятельно на ржаной муке, рисе, изюме, хмелевых шишках и других природных ингредиентах — интернет вам в помощь), а также такие растения, как артишоки, репчатый лук и лук-порей. Немного наших драгоценных бактерий содержится и в свежих бананах.

Также пробиотики часто выпускаются в виде пищевых добавок, перед употреблением которых следует обязательно посоветоваться с терапевтом.

Нормализация работы микрофлоры кишечника

Продукты для нормализации микрофлоры кишечника Royal-forest.org

Полезности в кишечник важно не только заселить, но и подкормить. Чтобы нужные бактерии почувствовали себя как дома, диетологи советуют включить в рацион:

  • Помидоры, морковь, яблоки, те же бананы, спаржу, чеснок, клубнику, малину, черную смородину (сезонные ягоды можно покупать в замороженном виде). Эти продукты в большом количестве содержат пребиотики — питательную среду, которая не усваивается организмом, а служит «обедом» микрофлоре;
  • Разнообразные овощи, цельнозерновой хлеб, овсяную кашу и иные продукты, содержащие большое количество клетчатки, она помогает полезным бактериям быстрее и легче прижиться в кишечнике, а также стимулирует кишечник очищаться от остатков, вызванных неправильным питанием в прошлом;
  • Редис, редьку, лук, чеснок, хрен и прочие продукты, подавляющие гнилостные процессы в организме. Они снижают нагрузки на полезную микрофлору, позволяя ей сосредоточиться на главных функциях, в том числе укреплении иммунитета.
Читайте також: Питання дня: чи прийматимуть лікарі, якщо не укладена декларація

Фото на главной: сmei.com.ua

Страничка автора на facebook 

Кишечный иммунитет управляет обменом веществ

Лимфоциты кишечника регулируют интенсивность метаболизма, действуя на кишечные клетки и кишечные гормоны.

В кишечнике очень много иммунных клеток, и неудивительно: во-первых, инфекции зачастую проникают в тело именно через кишечник, во-вторых, здесь же обитает масса симбиотических бактерий, без которых нам бы жилось намного труднее. Кишечный департамент иммунной системы должен постоянно уничтожать патогенных нарушителей и одновременно не трогать дружественную микрофлору.

Т-лимфоцит. (Фото: NIAID / Flickr.com)

Выросты эпителиальных клеток кишечника. (Фото Science 3.0 / Flickr.com)

Наши «домашние» кишечные бактерии влияют на множество физиологических процессов, и в первую очередь на обмен веществ. Можно предположить, что иммунитет, который постоянно общается с микрофлорой, косвенно действует и на метаболизм тоже – мы уже как-то писали, что иммунная система влияет на сахарный обмен через кишечных бактерий.

Но иммунные клетки, которые сидят в кишечнике, могут и сами регулировать обмен веществ. Известно, что Т-лимфоциты, которые сидят в кишечном эпителии, часто скапливаются там, где особенно активно всасываются питательные вещества; кроме того, у них активно работают гены, управляющие метаболизмом, и сами клетки путешествуют по эпителию не только когда организму угрожает какая-то инфекция, но и по каким-то другим причинам. 

Исследователи из Гарварда и Йеля с помощью генетических модификаций создали мышей, у которых лимфоциты лишены интегрина β7. Это мембранный белок, который помогает лимфоцитам взаимодействовать с эпителиальными клетками. В результате количество лимфоцитов в кишечном эпителии у таких мышей сильно падало.

Одновременно у животных разгонялся обмен веществ: бурый жир, задача которого – сжигать жировые запасы, вдруг начинал заниматься этим чрезвычайно активно, а поджелудочная железа начинала выбрасывать в кровь очень много инсулина, сильно снижая уровень сахара. Таких мышей пробовали держать на вредной диете с большим количеством жира и сахара, но, несмотря на вредную диету, у животных не появлялось признаков метаболического синдрома, который обычно сопутствует ожирению, диабету второго типа, проблем с сосудами и т. д.

Похожие вещи происходят при повышении уровня глюкагоноподобного пептида-1, который синтезируют так называемые L-клетки кишечного эпителия. Синтезируют они его либо под действием нервного сигнала, либо в ответ на появление сахара или желчных кислот (которые, в свою очередь, появляются в кишечнике в ответ на жиры). Глюкагоноподобный пептид-1 заставляет поджелудочную железу вырабатывать больше инсулина, и заодно стимулирует прирост инсулинсинтезирующих клеток. Кроме того, этот пептид замедляет перистальтику желудочно-кишечного тракта и заставляет нейроны отправлять в мозг сигналы насыщения. То есть в целом глюкагоноподобный пептид-1 помогает меньше есть и одновременно помогает избавляться от лишних калорий.

Поэтому возникла гипотеза, что иммунитет регулирует обмен веществ, действуя на этот пептид. Всё так и оказалось: в статье в Nature говорится, что у мышей, у которых в кишечнике было мало Т-лимфоцитов, было больше как пептида, так и синтезирующих его L-клеток. Иммунные клетки управляют обменом веществ напрямую, влияя на появление новых L-клеток и поглощая пептид, который они выделяют. Как пишет портал Nature, можно предположить, что иммунитет работает добавочным регулятором обмена веществ, настраивая его на разные условия среды. Ведь когда еды мало, то желательно, чтобы L-клетки и их пептид особо не активничали; и наоборот, когда еды много и организму, чего доброго, грозит ожирение, то L-клетки и их пептид должны работать, так сказать, не покладая рук.

Разумеется, тут сразу возникает вопрос, как сами Т-лимфоциты чувствуют, как нужно отрегулировать метаболизм. Очевидно, в иммунной системе для этого должен стоять некий «датчик снабжения», который определял бы, сколько в теле хранится запасов, как индивидуум питается и т. д.

С другой стороны, интересно, как Т-лимфоциты сочетают такую работу со своей прямой функцией – защитой организма от бактерий, вирусов и пр. Кишечные Т-лимфоциты работают в особых условиях, но ведь генетически они не отличаются от тех, которые находятся в других местах – значит, есть какие-то молекулярные механизмы, которые делают из кишечных Т-лимфоцитов тех, кто они есть.

Ответив на эти и другие вопросы, мы не только больше узнаем об иммунитете, но и, возможно, найдём новый способ бороться с избыточным весом, диабетом и прочими расстройствами, связанными с обменом веществ.

Найден ключ к балансу иммунитета и кишечника

Светлана МасловаФото: EAST NEWS

За гармонию двух систем отвечает единственная молекула. Если ее удалить, то микрофлора кишечника необратимо меняется, и ученые впервые проследили за этим процессом.

362

Иммунитет и микрофлора кишечника тесно связаны. С одной стороны, иммунная система защищает кишечник от распространения патогенов. С другой — микробиота кишечника напрямую влияет на силу иммунной реакции. Теперь ученые определили критический механизм, который отвечает за этот баланс.

Группа исследователей из Германии изучала регуляторные Т-клетки у мышей. Эти иммунные клетки предотвращают вторжения патогенов в микрофлору кишечника. Ученые идентифицировали молекулу c-Maf, которая имеет решающее значение для развития и функционирования этих клеток в кишечнике.

Если молекулы нет, иммунная система кишечника реагирует непропорционально. В этом случае состав микробиоты значительно меняется, объясняют авторы.

Команда провела эксперимент: перенесла измененную микробиоту мышам, у которых присутствовала c-Maf. Измененный состав оказался удивительно стабильным, признают ученые. В результате у грызунов развивалась такая же повышенная реакция иммунной системы кишечника.

Результаты доказывают, что иммунная система наравне с микробиотой способствует установлению и поддержанию баланса в кишечнике. Авторы считают, что выводы объясняют, каким образом дисбаланс в микрофлоре кишечника может приводить к хроническим воспалениям и почему терапия часто бывает неэффективной.

Открытие должно к новым терапевтическим подходам, надеются авторы. Например, в случае воспалительного заболевания кишечника терапия может быть направлена на гармонизацию как иммунного ответа, так и микробиоты.

Недавно ученые определили клеточный механизм, благодаря которому бактерии защищают кишечник, а значит — всю иммунную систему.

Facebook36Вконтакте2WhatsAppTelegram


Как здоровье кишечника влияет на иммунитет

Где у человека находится иммунитет? Везде. Но мало кому известно, что 80% всей имунной системы находится в нашем кишечнике (так называемые пейеровы бляшки и солитарные фолликулы). Именно здоровье нашего кишечника обеспечивает крепкий иммунитет и способность противостоять различным вирусам и вредным бактериям. Кишечная микрофлора имеет огромное влияние на нормализацию работы кишечника и укрепление иммунитета — участвует в усвоении витаминов, поступающих в организм с пищей. В сезон простуд и вирусов особенно важно понять, как можно поддержать полезную флору кишечника у взрослых и детей. 

Кишечник — второй мозг

Очевидными являются последствия нарушения микрофлоры, бьющие непосредственно по самочувствию желудочно-кишечного тракта: диарея, запор и прочие подобные неприятности. Менее очевидным является влияние полезных бактерий на подверженность заболеваниям, память, сон, настроение. Кишечник — огромный сенсорный орган: площадь поверхности кишечника превышает в 40 раз площадь поверхности нашей кожи. “Вторым мозгом” называет кишечник исследователь Руаири Робертсон из Университета Корка, Ирландия, в своем популярном выступлении на конференции TED: “Масса бактерий, живущих в кишечнике, составляет около 1,5 кг — это настоящий второй мозг. Всего 10% нервов нашего тела связывают кишечник и мозг, но около 90% этих нервов заняты отправкой информации только в одну сторону, то есть от кишечника к мозгу. Кишечник сообщает о количестве питательных веществ в пище, уровне 20 гормонов, которые в нем вырабатываются, уровне глюкозы и холестерина в крови, а также о состоянии иммунных клеток, большая часть которых находится именно в кишечнике. А что с вашим настроением и сном? За них отвечают нейромедиаторы — вещества, способные менять наши мысли и поведение, большинство их вырабатывается в желудочно-кишечном тракте. Например, серотонин, природный антидепрессант: 90% его производит именно кишечник, а мозг — менее 10%. Если у вас плохое настроение и одолевают мрачные мысли, спросите себя: что это я вчера съел? И примите меры”.

Вопрос здорового баланса

Свежие новости

Что вы понимаете под чистотой кишечника? Если в кишечнике слишком мало микроорганизмов, потому что вы постоянно его чистите, то это нехорошо. От этого может появляться аллергия или аутоиммунные заболевания, считает доктор Джулия Эндерс, автор популярной книги “Очаровательный кишечник. Как самый могущественный орган управляет нами”. Она говорит, что 95% бактерий на этой планете не приносят нам вреда. Некоторые нам даже здорово помогают. Сейчас ученые изучают, как некоторые бактерии помогают чистить кишечник, заставляют нас худеть или поправляться, некоторые микробы, возможно,  могут сделать нас более устойчивыми к стрессу или более смелыми. Избежать встречи с плохими микробами невозможно, уничтожить их полностью — тоже. Речь о здоровом балансе. Нужно иметь много хороших бактерий и немножко плохих, потому что они тоже очень важны для иммунной системы, которая должна хотя бы знать, что искать. Ученые в Университете Корка, Ирландия, выяснили, что тип жиров, которые употребляет организм, способен влиять на состав микрофлоры в кишечнике, а «подкармливая» определенные штаммы кишечных бактерий, можно влиять на качество памяти, стрессовое поведение и гормоны. Вот список продуктов, которые могут служить пребиотиками, создавая среду для полезных кишечных бактерий:

  • цельные крупы
  • яблоки
  • лук
  • чеснок
  • бананы
  • спаржа
  • мед
  • орехи
  • корнеплоды
  • бобовые
  • экстракты зеленого чая, какао и красного вина.

Факторы риска

Правильный баланс микроорганизмов в кишечнике может предотвратить болезни и продлить жизнь. Мы знаем, что прием антибиотиков и плохая экология резко ухудшают состояние микрофлоры. Но не только это подвергает опасности здоровье полезных микробов.
Что вредит микрофлоре:

Однообразное питание

Рацион современных людей гораздо беднее того, который был привычен нашим предкам. Мы едим слишком много обработанных продуктов, выбор которых совсем небогат. Поэтому и наша микрофлора не справляется со своими функциями из-за губительного однообразия.

Алкоголь

Злоупотребление алкоголем приводит к дисбактериозу, однако умеренное употребление красного вина улучшает состояние микрофлоры.

Недостаток сна

У кишечника есть свой циркадный ритм, если нарушать его и есть, например, слишком поздно, то это повредит полезным микробам.

Стресс

Совсем избежать его нельзя, но ученые выяснили в ходе экспериментов, что кишечной флоре вреден стресс от изоляции, перевозбуждения из-за пребывания в переполненном людьми пространстве, перегрева.

Ученые сейчас работают над тем, чтобы выяснить, как именно взаимосвязаны все эти факторы: что улучшает микрофлору и как хорошая микрофлора помогает бороться со стрессом, бессонницей, тревожностью и депрессией. Однако они единодушны: взаимосвязь точно есть!

Нехватка витамина Д

Он не только отвечает за крепость костей, как нас учили. Витамин Д нужен также для регуляции и поддержки иммунной системы, а его участие в обмене кальция делает его важным фактором для здорового сна. Взаимосвязь сна, кишечной флоры, витамина Д и общего здоровья доказана. Сложно установить без лабораторных анализов, есть ли у вас недостаток витамина Д, но считается, что у значительной части жителей Северного полушария все-таки он есть, ведь частично витамин Д поступает в организм с продуктами питания (печень трески, сардина, тунец, лососевые рыбы, коровье молоко, яйца), но большая доля вырабатывается организмом под воздействием солнечных лучей, которых в наших краях бывает совсем немного, особенно в осенне-зимний период. В Украине у 80% взрослого населения и у 90% детей от 10 до 18 лет, есть недостаток витамина Д. Отсюда увеличение количества заболеваний мышечной и костной систем, снижение иммунитета и, как следствие, резкий всплеск простудных заболеваний! Как же быстро и эффективно улучшить состояние микрофлоры и повысить уровень витамина Д? Не всегда получается мгновенно наладить здоровое питание и распорядок дня, а о загаре на пляже зимой приходится только мечтать.

Помощь в восстановлении микрофлоры

В таком случае помогут качественные пробиотики: препараты, содержащие достаточное количество полезных бактерий, готовых приняться за работу по восстановлению здоровья кишечника и всего организма, и препараты витамина Д. А еще лучше, когда полезные бактерии и витамин Д сконцентрированы в одном препарате. Именно такую комбинацию содержит шведский пробиотик БиоГая Протектис с витамином D3. Штамм пробиотика L.reuteri DSM17938 в составе БиоГая рекомендован Всемирной гастроэнтерологической организацией, Ассоциацией неонатологов Украины и рядом европейских и американских профессиональных медицинских ассоциаций. В чем его особенность:

  • Шведское качество и удобство в применении: вам нужна всего 1 вкусная жевательная таблетка в день.
  • В 1 таблетке содержится: не менее 10⁸ КОЕ жизнеспособных бактерий Lactobacillus reuteri DSM 17938 и 10 мкг (400 МЕ) витамина D3.
  • В отличие от пробиотиков в капсулах и саше БиоГая начинает работать уже в ротовой полости и на протяжении всего ЖКТ.
  • Только шведская лаборатория БиоГая владеет патентами на несколько штаммов Lactobacillus reuteri, содержащихся в препарате.
  • В кишечнике человека Lactobacillus reuteri выделяет антимикробное вещество реутерин, способное угнетать рост таких болезнетворных бактерий, как кишечная палочка, сальмонелла, стафилококк, а также дрожжей, грибков и вирусов.
  • Подходит детям от 3-х лет и взрослым. Не содержит консервантов и аллергенов – лактозу и белки коровьего молока, не содержит ГМО.

Таким образом, для укрепления иммунитета, для здоровья и долголетия, нам необходимо позаботиться о балансе микрофлоры кишечника. Мы должны создать условия для развития полезных кишечных бактерий, употребляя здоровую еду, в случае необходимости “заселить” ими обедневший микробиом с помощью препаратов, нормализовать сон и физическую активность — тогда мы создадим фундамент для нашего здоровья. А витамин Д3 даст  нам дополнительную силу для борьбы с вирусами и патогенными бактериями!

 

Региональная специализация в рамках кишечной иммунной системы

  • 1

    Ouellette, A.J. Paneth клетки и врожденный иммунитет слизистой оболочки. Curr. Opin. Гастроэнтерол. 26 , 547–553 (2010).

    Артикул PubMed Google Scholar

  • 2

    Клеверс, Х. К. и Бевинс, С. Л. Клетки Панета: маэстро крипт тонкого кишечника. Annu. Rev. Physiol. 75 , 289–311 (2013). Этот обзор посвящен физиологии и функциям клеток Панета.

    CAS Статья PubMed Google Scholar

  • 3

    Sato, T. et al. Клетки Панета составляют нишу для стволовых клеток Lgr5 в кишечных криптах. Природа 469 , 415–418 (2011).

    CAS Статья PubMed Google Scholar

  • 4

    Adolph, T. E. et al. Клетки Панета как источник воспаления кишечника. Природа 503 , 272–276 (2013).

    CAS Статья PubMed PubMed Central Google Scholar

  • 5

    Cadwell, K. et al. Ключевая роль в аутофагии и гене аутофагии Atg16l1 в кишечных клетках Панета мыши и человека. Природа 456 , 259–263 (2008).

    CAS Статья PubMed PubMed Central Google Scholar

  • 6

    Gunther, C. et al.Каспаза-8 регулирует TNF-α-индуцированный эпителиальный некроптоз и терминальный илеит. Природа 477 , 335–339 (2011).

    Артикул CAS PubMed PubMed Central Google Scholar

  • 7

    Wittkopf, N. et al. Отсутствие кишечного эпителия Atg7 влияет на образование гранул клеток Панета, но не нарушает иммунный гомеостаз в кишечнике. Clin. Dev. Иммунол. 2012 , 278059 (2012).

    Артикул PubMed PubMed Central Google Scholar

  • 8

    Kaser, A. & Blumberg, R. S. Аутофагия, микробное зондирование, стресс эндоплазматического ретикулума и функция эпителия при воспалительном заболевании кишечника. Гастроэнтерология 140 , 1738–1747 (2011). Это доступный обзор, в котором эпителиальные клетки кишечника рассматриваются в иммунологическом и анатомическом контексте.

    CAS Статья PubMed PubMed Central Google Scholar

  • 9

    Вандуссен, К.L. et al. Генетические варианты синтезируются для производства фенотипов клеток Панета, которые определяют подтипы болезни Крона. Гастроэнтерология 146 , 200–209 (2014).

    CAS Статья PubMed Google Scholar

  • 10

    Лю Б. и др. Мыши с дефицитом Irgm1 обнаруживают аномалии клеток Панета и повышенную восприимчивость к острому воспалению кишечника. г. J. Physiol. Гастроинтест. Liver Physiol. 305 , G573 – G584 (2013).

    CAS Статья PubMed PubMed Central Google Scholar

  • 11

    Johansson, M. E. et al. Внутренний из двух слоев слизи, зависимой от муцина Muc2 в толстой кишке, лишен бактерий. Proc. Natl Acad. Sci. США 105 , 15064–15069 (2008). Это исследование описывает структуру и свойства слизистого слоя в различных частях кишечника.

    CAS Статья PubMed Google Scholar

  • 12

    Ханссон, Г.C. Роль слоев слизи в инфекциях и воспалениях кишечника. Curr. Opin. Microbiol. 15 , 57–62 (2012).

    CAS Статья PubMed Google Scholar

  • 13

    Бэнкрофт, А. Дж., Маккензи, А. Н. и Гренцис, Р. К. Критическая роль IL-13 в устойчивости к кишечной нематодной инфекции. J. Immunol. 160 , 3453–3461 (1998).

    CAS PubMed Google Scholar

  • 14

    Steenwinckel, V.и другие. IL-9 способствует зависимой от IL-13 гиперплазии клеток Панета и активации медиаторов врожденного иммунитета в слизистой оболочке кишечника. J. Immunol. 182 , 4737–4743 (2009).

    CAS Статья PubMed Google Scholar

  • 15

    Klose, C. S. et al. Градиент T-bet контролирует судьбу и функцию CCR6 RORγt + врожденных лимфоидных клеток. Природа 494 , 261–265 (2013).

    CAS Статья PubMed Google Scholar

  • 16

    Johansson, M. E. et al. Состав и функциональная роль слизистых слоев кишечника. Ячейка. Мол. Life Sci. 68 , 3635–3641 (2011).

    CAS Статья PubMed Google Scholar

  • 17

    Velcich, A. et al. Колоректальный рак у мышей с генетическим дефицитом муцина Muc2. Наука 295 , 1726–1729 (2002).

    CAS Статья PubMed Google Scholar

  • 18

    Van der Sluis, M. et al. У мышей с дефицитом Muc2 спонтанно развивается колит, что указывает на то, что MUC2 имеет решающее значение для защиты толстой кишки. Гастроэнтерология 131 , 117–129 (2006).

    CAS Статья PubMed Google Scholar

  • 19

    Заф, К.и другие. Экспрессия IKK-β, присущая эпителиальным клеткам, регулирует иммунный гомеостаз кишечника. Природа 446 , 552–556 (2007).

    CAS Статья PubMed Google Scholar

  • 20

    Rescigno, M. Кишечный эпителиальный барьер в контроле гомеостаза и иммунитета. Trends Immunol. 32 , 256–264 (2011).

    CAS Статья PubMed Google Scholar

  • 21

    Мальдонадо-Контрерас, А.Л. и Маккормик, Б. А. Эпителиальные клетки кишечника и их роль в врожденном иммунитете слизистой оболочки. Cell Tissue Res. 343 , 5–12 (2011).

    CAS Статья PubMed Google Scholar

  • 22

    Wang, Y. et al. Региональная микробиота слизистой оболочки определяет физиологическую экспрессию TLR2 и TLR4 в толстой кишке мышей. PLoS ONE 5 , e13607 (2010).

    Артикул CAS PubMed PubMed Central Google Scholar

  • 23

    Ортега-Кава, К.F. et al. Стратегическая компартментализация Toll-подобного рецептора 4 в кишечнике мыши. J. Immunol. 170 , 3977–3985 (2003).

    CAS Статья PubMed Google Scholar

  • 24

    Lala, S. et al. Болезнь Крона и ген NOD2: роль клеток Панета. Гастроэнтерология 125 , 47–57 (2003).

    CAS Статья PubMed Google Scholar

  • 25

    Барретт, Дж.C. et al. Общегеномная ассоциация определяет более 30 различных локусов восприимчивости к болезни Крона. Nature Genet. 40 , 955–962 (2008).

    CAS Статья PubMed Google Scholar

  • 26

    Hugot, J. P. et al. Ассоциация вариантов с высоким содержанием лейцина NOD2 с предрасположенностью к болезни Крона. Nature 411 , 599–603 (2001).

    CAS Статья PubMed Google Scholar

  • 27

    Мабботт, Н.А., Дональдсон, Д. С., Оно, Х., Уильямс, И. Р. и Махаджан, А. Клетки с микроскладкой (М): важные посты иммунного надзора в кишечном эпителии. Mucosal Immunol. 6 , 666–677 (2013). В этом обзоре описывается расположение, функции и развитие М-клеток в разных местах.

    CAS Статья PubMed PubMed Central Google Scholar

  • 28

    Корнс, Дж. С. Количество, размер и распределение пейеровых бляшек в тонкой кишке человека: Часть I Развитие пейеровых бляшек. Кишечник 6 , 225–229 (1965).

    CAS Статья PubMed PubMed Central Google Scholar

  • 29

    Оуэн, Р. Л., Пьяцца, А. Дж. И Ермак, Т. Х. Ультраструктурные и цитоархитектурные особенности лимфоретикулярных органов толстой и прямой кишки взрослых мышей BALB / c. г. J. Anat. 190 , 10–18 (1991).

    CAS Статья PubMed Google Scholar

  • 30

    Перри, Г.А. и Шарп, Дж. Г. Характеристика лимфоидной ткани проксимального отдела толстой кишки у мышей. Анат. Рек. 220 , 305–312 (1988).

    CAS Статья PubMed Google Scholar

  • 31

    Lee, A. Y. et al. Дендритные клетки в участках толстой кишки и подвздошных лимфатических узлах важны для индукции IgA слизистой оболочки после интраректального введения через взаимодействие CCR7. евро. J. Immunol. 38 , 1127–1137 (2008).

    CAS Статья PubMed Google Scholar

  • 32

    Masahata, K. et al. Образование IgA-секретирующих клеток толстой кишки в пластыре слепой кишки. Nature Commun. 5 , 3704 (2014). Это новое исследование показывает, что распознавание кишечной микробиоты в пейеровских бляшках и бляшках слепой кишки приводит к образованию IgA-продуцирующих плазматических клеток в тонком и толстом кишечнике, соответственно.

    Артикул CAS Google Scholar

  • 33

    Баптиста, А.P. et al. Появление пластыря толстой кишки и ИВЛТ толстой кишки являются независимыми и регулируются по-разному. Mucosal Immunol. 6 , 511–521 (2013).

    CAS Статья PubMed Google Scholar

  • 34

    Хербранд, Х., Бернхардт, Г., Форстер, Р. и Пабст, О. Динамика и функция единственной лимфоидной ткани кишечника. Crit. Rev. Immunol. 28 , 1–13 (2008). В этом обзоре обсуждаются ILF, которые обнаруживаются в различных областях кишечника.

    CAS Статья PubMed Google Scholar

  • 35

    Pabst, O. et al. Криптопаты и изолированные лимфоидные фолликулы: динамические лимфоидные ткани, необходимые для образования интраэпителиальных лимфоцитов. евро. J. Immunol. 35 , 98–107 (2005).

    CAS Статья PubMed Google Scholar

  • 36

    Tsuji, M. et al. Потребность в клетках-индукторах лимфоидной ткани в формировании изолированного фолликула и в генерации независимого от Т-клеток иммуноглобулина А в кишечнике. Иммунитет 29 , 261–271 (2008).

    CAS Статья PubMed Google Scholar

  • 37

    Kanamori, Y. et al. Идентификация новых лимфоидных тканей в слизистой оболочке кишечника мышей, где развиваются кластеры c-kit + IL-7R + Thy1 + лимфо-гемопоэтических предшественников. J. Exp. Med. 184 , 1449–1459 (1996).

    CAS Статья PubMed Google Scholar

  • 38

    Бускра, Д.и другие. Генезис лимфоидной ткани, индуцированный комменсалами через NOD1, регулирует гомеостаз кишечника. Природа 456 , 507–510 (2008).

    CAS Статья PubMed Google Scholar

  • 39

    Trepel, F. Число и распределение лимфоцитов у человека. Критический анализ. Клин. Wochenschr. 52 , 511–515 (1974).

    CAS Статья PubMed Google Scholar

  • 40

    Могхаддами, М., Cummins, A. & Mayrhofer, G. Наполненные лимфоцитами ворсинки: сравнение с другими лимфоидными скоплениями в слизистой оболочке тонкой кишки человека. Гастроэнтерология 115 , 1414–1425 (1998).

    CAS Статья PubMed Google Scholar

  • 41

    О’Лири, А. Д. и Суини, Е. С. Лимфогландулярные комплексы толстой кишки: структура и распределение. Гистопатология 10 , 267–283 (1986).

    CAS Статья PubMed Google Scholar

  • 42

    Hamada, H. et al. Идентификация множественных изолированных лимфоидных фолликулов на антимезентериальной стенке тонкого кишечника мыши. J. Immunol. 168 , 57–64 (2002).

    CAS Статья PubMed Google Scholar

  • 43

    Макдональд, К. Г., МакДонаф, Дж. С., Дикгрейф, Б. К.& Newberry, R.D. Дендритные клетки продуцируют CXCL13 и участвуют в развитии лимфоидной ткани тонкого кишечника мышей. г. J. Pathol. 176 , 2367–2377 (2010).

    CAS Статья PubMed PubMed Central Google Scholar

  • 44

    Velaga, S. et al. Хемокиновый рецептор CXCR5 поддерживает образование одиночной кишечной лимфоидной ткани, возвращение В-клеток и индукцию кишечных IgA-ответов. J. Immunol. 182 , 2610–2619 (2009).

    CAS Статья PubMed Google Scholar

  • 45

    Кноп, К. А., Батлер, Б. Р., Кумар, Н., Ньюберри, Р. Д. и Уильямс, И. Р. Четкие требования развития для образования изолированных лимфоидных фолликулов в тонком и толстом кишечнике: RANKL важен только в тонком кишечнике. г. J. Pathol. 179 , 1861–1871 (2011). Это одно из немногих исследований, в котором напрямую сравнивается развитие вторичных лимфоидных органов в тонком и толстом кишечнике.

    CAS Статья PubMed PubMed Central Google Scholar

  • 46

    Тилни, Н. Л. Особенности лимфатического дренажа у взрослых лабораторных крыс. J. Anat. 109 , 369–383 (1971).

    CAS PubMed PubMed Central Google Scholar

  • 47

    Картер П. Б. и Коллинз Ф. М. Путь кишечной инфекции у нормальных мышей. J. Exp. Med. 139 , 1189–1203 (1974).

    CAS Статья PubMed PubMed Central Google Scholar

  • 48

    Ван ден Брук В., Дерор А. и Симоенс П. Анатомия и номенклатура лимфатических узлов мышей: описательное исследование и номенклатурная стандартизация на мышах BALB / cAnNCrl. J. Immunol. Методы 312 , 12–19 (2006).

    CAS Статья PubMed Google Scholar

  • 49

    Фергюсон, А.Интраэпителиальные лимфоциты тонкой кишки. Кишечник 18 , 921–937 (1977).

    CAS Статья PubMed PubMed Central Google Scholar

  • 50

    Шеридан, Б.С. и Лефранкоис, Л. Интраэпителиальные лимфоциты: служить и защищать. Curr. Гастроэнтерол. Реп. 12 , 513–521 (2010).

    Артикул PubMed PubMed Central Google Scholar

  • 51

    Cheroutre, H., Ламболез, Ф. и Муцида, Д. Светлая и темная стороны кишечных интраэпителиальных лимфоцитов. Nature Rev. Immunol. 11 , 445–456 (2011).

    CAS Статья Google Scholar

  • 52

    Хейдей, А. и Гиббонс, Д. Посредничество мира: происхождение кишечных Т-клеток. Mucosal Immunol. 1 , 172–174 (2008). В этом обзоре дается определение концепции отдельных онтогенных и функциональных подмножеств IEL.

    CAS Статья PubMed PubMed Central Google Scholar

  • 53

    Gangadharan, D. et al. Идентификация пред- и постселективных предшественников интраэпителиальных лимфоцитов TCRαβ + в тимусе. Иммунитет 25 , 631–641 (2006).

    CAS Статья PubMed Google Scholar

  • 54

    Побезинский Л.А. и др.Клональная делеция и судьба аутореактивных тимоцитов, переживших отрицательный отбор. Nature Immunol. 13 , 569–578 (2012).

    CAS Статья Google Scholar

  • 55

    Leishman, A. J. et al. Предшественники функциональных Т-лимфоцитов CD8αα + , ограниченных МНС класса I или класса II, позитивно отбираются в тимусе агонистическими самопептидами. Иммунитет 16 , 355–364 (2002).

    CAS Статья PubMed Google Scholar

  • 56

    Beagley, K. W. et al. Различия в субпопуляциях интраэпителиальных лимфоцитов Т-клеток, выделенных из тонкого и толстого кишечника мышей. J. Immunol. 154 , 5611–5619 (1995).

    CAS PubMed Google Scholar

  • 57

    Болл, Г., Рудольфи, А., Списс, С. и Рейманн, Дж. Региональная специализация интраэпителиальных Т-клеток в тонком и толстом кишечнике мышей. Сканд. J. Immunol. 41 , 103–113 (1995).

    CAS Статья PubMed Google Scholar

  • 58

    Камерини В., Панвала К. и Кроненберг М. Региональная специализация иммунной системы слизистых оболочек. Внутриэпителиальные лимфоциты толстой кишки имеют другой фенотип и функции, чем лимфоциты тонкой кишки. J. Immunol. 151 , 1765–1776 (1993). Это исследование представляет собой прямое сравнение интраэпителиальных лимфоцитов в тонком и толстом кишечнике.

    CAS PubMed Google Scholar

  • 59

    Suzuki, K. et al. Криптопатчи кишечника: прямое свидетельство наличия экстратимических анатомических участков кишечного Т-лимфопоэза. Иммунитет 13 , 691–702 (2000).

    CAS Статья PubMed Google Scholar

  • 60

    Ибрагимов, А. Р. и Линч, Р. Г. Гетерогенность и смещенный репертуар альфа / бета-рецепторов Т-лимфоцитов CD8 + клеток слизистой оболочки толстой кишки мышей: влияние на функциональное состояние. J. Exp. Med. 180 , 433–444 (1994).

    CAS Статья PubMed Google Scholar

  • 61

    Bandeira, A. et al. Локализация γ / δ Т-клеток в эпителии кишечника не зависит от нормальной микробной колонизации. J. Exp. Med. 172 , 239–244 (1990).

    CAS Статья PubMed Google Scholar

  • 62

    Suzuki, H., Jeong, K. I., Itoh, K. & Doi, K. Региональные различия в распределении интраэпителиальных лимфоцитов тонкого кишечника у мышей, свободных от микробов и определенных патогенов. Exp. Мол. Патол. 72 , 230–235 (2002).

    CAS Статья PubMed Google Scholar

  • 63

    Jiang, W. et al. Распознавание кишечной микробиоты с помощью NOD2 необходимо для гомеостаза кишечных интраэпителиальных лимфоцитов. Дж.Exp. Med. 210 , 2465–2476 (2013).

    CAS Статья PubMed PubMed Central Google Scholar

  • 64

    Селби, В. С., Джаносси, Г. и Джуэлл, Д. П. Иммуногистологическая характеристика интраэпителиальных лимфоцитов желудочно-кишечного тракта человека. Кишечник 22 , 169–176 (1981).

    CAS Статья PubMed PubMed Central Google Scholar

  • 65

    Лундквист, К., Баранов, В., Хаммарстром, С., Атлин, Л., Хаммарстром, М. Л. Внутриэпителиальные лимфоциты. Доказательства региональной специализации и созревания экстратимических Т-клеток в эпителии кишечника человека. Внутр. Иммунол. 7 , 1473–1487 (1995).

    CAS Статья PubMed Google Scholar

  • 66

    Джабри Б. и Эберт Е. Человеческие CD8 + интраэпителиальные лимфоциты: уникальная модель для изучения регуляции эффекторных цитотоксических Т-лимфоцитов в ткани. Immunol. Ред. 215 , 202–214 (2007).

    CAS Статья PubMed Google Scholar

  • 67

    Иванов И.И. и др. Орфанный ядерный рецептор RORγt управляет программой дифференцировки провоспалительных Т-хелперных клеток IL-17 + . Cell 126 , 1121–1133 (2006).

    CAS Статья PubMed Google Scholar

  • 68

    Мейнард, К.L. et al. Регуляторные Т-клетки, экспрессирующие интерлейкин 10, развиваются из клеток-предшественников Foxp3 + и Foxp3 в отсутствие интерлейкина 10. Nature Immunol. 8 , 931–941 (2007).

    CAS Статья Google Scholar

  • 69

    Sathaliyawala, T. et al. Распределение и компартментализация циркулирующих и тканевых субпопуляций Т-клеток памяти человека. Иммунитет 38 , 187–197 (2013).

    CAS Статья PubMed Google Scholar

  • 70

    Veenbergen, S. & Samsom, J. N. Поддержание толерантности тонкого кишечника и толстой кишки с помощью субпопуляций регуляторных Т-клеток, продуцирующих IL-10. Curr. Opin. Иммунол. 24 , 269–276 (2012). Это обзор механизмов, которые могут контролировать толерантность в различных сегментах кишечника.

    CAS Статья PubMed Google Scholar

  • 71

    Деннинг, Т.L. et al. Функциональная специализация субпопуляций дендритных клеток и макрофагов кишечника, которые контролируют Th27 и ответы регуляторных Т-клеток, зависит от соотношения Т-лимфоциты / АРС, источника линии мышей и региональной локализации. J. Immunol. 187 , 733–747 (2011). Это подробное исследование описывает градиенты DC, макрофагов, эффекторных Т-клеток и T Reg клеток по длине кишечника.

    CAS Статья PubMed PubMed Central Google Scholar

  • 72

    Вольф, М.J. et al. Клетки Th27, Th32 и TReg обогащены слепой кишкой здорового человека. PLoS ONE 7 , e41373 (2012).

    CAS Статья PubMed PubMed Central Google Scholar

  • 73

    Brandtzaeg, P. Функция лимфоидной ткани, связанной со слизистой оболочкой, в образовании антител. Immunol. Вкладывать деньги. 39 , 303–355 (2010).

    CAS Статья PubMed Google Scholar

  • 74

    Brandtzaeg, P., Карлсен, Х. и Фарстад, И. Н. в Mucosal Immunology , 3-е издание (ред. Местецки, Дж. И др.) 617–665 (Academic Press, 2005).

    Google Scholar

  • 75

    Brandtzaeg, P. & Johansen, F.E. В-клетки слизистой оболочки: фенотипические характеристики, регуляция транскрипции и свойства самонаведения. Immunol. Ред. 206 , 32–63 (2005).

    CAS Статья PubMed Google Scholar

  • 76

    Смит П.Д., Макдональд, Т. Т. и Блумберг, Р. С. в Принципах иммунологии слизистой оболочки (редакторы Смит П. Д., Макдональд Т. Т. и Блумберг Р. С.) 103–119 (Garland Science, 2013).

    Google Scholar

  • 77

    Kett, K., Brandtzaeg, P., Radl, J. & Haaijman, J. J. Распределение различных подклассов IgA-продуцирующих клеток в лимфоидных органах человека и различных секреторных тканях. J. Immunol. 136 , 3631–3635 (1986).

    CAS PubMed Google Scholar

  • 78

    Crago, S. S. et al. Распределение клеток, содержащих цепи IgA1, IgA2 и J, в тканях человека. J. Immunol. 132 , 16–18 (1984).

    CAS PubMed Google Scholar

  • 79

    He, B. et al. Кишечные бактерии запускают Т-клеточно-независимое переключение класса иммуноглобулинов А2, индуцируя секрецию цитокина APRIL эпителиальными клетками. Иммунитет 26 , 812–826 (2007).

    CAS Статья PubMed Google Scholar

  • 80

    Lin, M., Du, L., Brandtzaeg, P. & Pan-Hammarstrom, Q. Рекомбинация переключения подкласса IgA в слизистой оболочке человека и в компартментах системного иммунитета. Mucosal Immunol. 7 , 511–520 (2014). Это исследование дает исчерпывающее описание специализации изотипа IgA в различных сегментах кишечника.

    CAS Статья PubMed Google Scholar

  • 81

    Kett, K. et al. Изотипический ответ кишечных B-клеток в зависимости от местной бактериальной нагрузки: доказательства адаптации подкласса иммуноглобулинов А. Гастроэнтерология 109 , 819–825 (1995).

    CAS Статья PubMed Google Scholar

  • 82

    Plaut, A. G., Wistar, R. Jr & Capra, J.D. Дифференциальная чувствительность иммуноглобулинов IgA человека к протеазе IgA стрептококка. J. Clin. Вкладывать деньги. 54 , 1295–1300 (1974).

    CAS Статья PubMed PubMed Central Google Scholar

  • 83

    Килиан, М., Райнхольдт, Дж., Ломхольт, Х., Поульсен, К. и Франдсен, Э. В. Биологическое значение протеаз IgA1 в бактериальной колонизации и патогенезе: критическая оценка экспериментальных данных. APMIS 104 , 321–338 (1996).

    CAS Статья PubMed Google Scholar

  • 84

    Боннер А., Альмогрен А., Фуртадо П. Б., Керр М. А. и Перкинс С. Дж. Непланарные секреторные структуры раствора IgA2 и почти планарные секреторные структуры раствора IgA1 рационализируют их различные иммунные ответы слизистых оболочек. J. Biol. Chem. 284 , 5077–5087 (2009).

    CAS Статья PubMed PubMed Central Google Scholar

  • 85

    Тарковский, А.и другие. Иммунизация людей полисахаридными вакцинами вызывает системные, преимущественно полимерные антитела подкласса IgA2. J. Immunol. 144 , 3770–3778 (1990).

    CAS PubMed Google Scholar

  • 86

    Пакканен, С. Х. и др. Экспрессия хоминговых рецепторов на плазмобластах IgA1 и IgA2 в крови отражает дифференциальное распределение IgA1 и IgA2 в различных жидкостях организма. Clin. Вакцина Иммунол. 17 , 393–401 (2010).

    CAS Статья PubMed PubMed Central Google Scholar

  • 87

    Spits, H. et al. Врожденные лимфоидные клетки — предложение единой номенклатуры. Nature Rev. Immunol. 13 , 145–149 (2013). Это важный обзор, который определяет текущую классификацию ILC.

    CAS Статья Google Scholar

  • 88

    Вонарбург, К.и другие. Регулируемая экспрессия ядерного рецептора RORγt обеспечивает различные функциональные судьбы врожденным лимфоцитам RORγt + , экспрессирующим рецептор NK-клеток. Иммунитет 33 , 736–751 (2010).

    CAS Статья PubMed PubMed Central Google Scholar

  • 89

    Nussbaum, J. C. et al. Врожденные лимфоидные клетки 2 типа контролируют гомеостаз эозинофилов. Природа 502 , 245–248 (2013).

    CAS Статья PubMed PubMed Central Google Scholar

  • 90

    Mjosberg, J. M. et al. Человеческие IL-25- и IL-33-чувствительные врожденные лимфоидные клетки 2 типа определяются по экспрессии CRTh3 и CD161. Nature Immunol. 12 , 1055–1062 (2011).

    Артикул CAS Google Scholar

  • 91

    Sawa, S. et al. Анализ родственных связей врожденных лимфоидных клеток RORγt + . Наука 330 , 665–669 (2010).

    CAS Статья PubMed Google Scholar

  • 92

    Чен, В. Л., Сурана, Н. К., Дуан, Дж. И Каспер, Д. Л. Роль клеток лимфоидной ткани, экспрессирующих рецептор 1 лимфоидной ткани кишечного тракта мыши, в инфекции Salmonella . PLoS ONE 8 , e65405 (2013).

    CAS Статья PubMed PubMed Central Google Scholar

  • 93

    Туманов, А.V. et al. Лимфотоксин контролирует путь защиты IL-22 в врожденных лимфоидных клетках кишечника во время заражения патогеном слизистой оболочки. Cell Host Microbe 10 , 44–53 (2011).

    CAS Статья PubMed PubMed Central Google Scholar

  • 94

    Satoh-Takayama, N. et al. Независимое от рецептора лимфотоксина β развитие кишечных IL-22-продуцирующих NKp46 + врожденных лимфоидных клеток. евро. J. Immunol. 41 , 780–786 (2011).

    CAS Статья PubMed Google Scholar

  • 95

    Reynders, A. et al. Идентичность, регуляция и функция in vivo кишечных NKp46 + RORγt + и NKp46 + RORγt лимфоидных клеток. EMBO J. 30 , 2934–2947 (2011).

    CAS Статья PubMed PubMed Central Google Scholar

  • 96

    Lecuyer, E.и другие. Сегментированные нитчатые бактерии используют вторичные и третичные лимфоидные ткани для индукции ответа кишечных IgA и специфических Т-хелперных 17 клеток. Иммунитет 40 , 608–620 (2014). В этом недавнем отчете описывается, как SFB взаимодействует с вторичными лимфоидными тканями кишечника, формируя функции местных иммунных клеток.

    CAS Статья PubMed Google Scholar

  • 97

    Le Bourhis, L. et al.Связанные со слизистой оболочкой инвариантные Т-клетки: нетрадиционное развитие и функция. Trends Immunol. 32 , 212–218 (2011).

    CAS Статья PubMed Google Scholar

  • 98

    Dunne, M. R. et al. Устойчивые изменения в подмножествах циркулирующих и кишечных γδ Т-клеток, инвариантных естественных Т-киллеров и инвариантных Т-клеток, связанных со слизистой оболочкой, у детей и взрослых с целиакией. PLoS ONE 8 , e76008 (2013).

    CAS Статья PubMed PubMed Central Google Scholar

  • 99

    Gold, M. C. & Lewinsohn, D. M. Созависимые: MR1-ограниченные клетки MAIT и их антимикробная функция. Nature Rev. Microbiol. 11 , 14–19 (2013).

    CAS Статья Google Scholar

  • 100

    Kjer-Nielsen, L. et al. MR1 представляет микробные метаболиты витамина B клеткам MAIT. Природа 491 , 717–723 (2012). В этой статье дается первое описание того, как предпочтительное расположение клеток MAIT отражает их распознавание микробных продуктов.

    CAS Статья PubMed Google Scholar

  • 101

    Patel, O. et al. Распознавание метаболитов витамина B инвариантными Т-клетками, связанными со слизистой оболочкой. Nature Commun. 4 , 2142 (2013).

    Артикул CAS Google Scholar

  • 102

    Реантрагун, Р.и другие. Нагруженные антигеном тетрамеры MR1 определяют гетерогенность Т-клеточного рецептора в связанных со слизистой оболочкой инвариантных Т-клетках. J. Exp. Med. 210 , 2305–2320 (2013).

    CAS Статья PubMed PubMed Central Google Scholar

  • 103

    Dusseaux, M. et al. Клетки MAIT человека представляют собой устойчивые к ксенобиотикам, нацеленные на ткани, CD161 hi Т-клетки, секретирующие IL-17. Кровь 117 , 1250–1259 (2011).

    CAS Статья PubMed Google Scholar

  • 104

    Le Bourhis, L. et al. Клетки MAIT обнаруживают и эффективно лизируют инфицированные бактериями эпителиальные клетки. PLoS Pathog. 9 , e1003681 (2013).

    Артикул CAS PubMed PubMed Central Google Scholar

  • 105

    Zeissig, S. & Blumberg, R. S. Комменсальная микробиота и NKT-клетки в контроле воспалительных заболеваний на поверхности слизистых оболочек. Curr. Opin. Иммунол. 25 , 690–696 (2013).

    CAS Статья PubMed Google Scholar

  • 106

    Вингендер, Г. и Кроненберг, М. Роль NKT-клеток в пищеварительной системе. IV. Роль канонических естественных Т-клеток-киллеров в иммунитете и воспалении слизистых оболочек. г. J. Physiol. Гастроинтест. Liver Physiol. 294 , G1 – G8 (2008).

    CAS Статья PubMed Google Scholar

  • 107

    Вингендер, Г.и другие. Кишечные микробы влияют на фенотип и функции инвариантных естественных Т-клеток-киллеров у мышей. Гастроэнтерология 143 , 418–428 (2012).

    CAS Статья PubMed PubMed Central Google Scholar

  • 108

    Olszak, T. et al. Воздействие микробов в молодом возрасте оказывает стойкое влияние на функцию естественных Т-клеток-киллеров. Наука 336 , 489–493 (2012).

    CAS Статья PubMed PubMed Central Google Scholar

  • 109

    Ло, Л., Иварссон, М. А., Михаэльссон, Дж., Сандберг, Дж. К. и Никсон, Д. Ф. Инвариантные естественные Т-клетки-киллеры, развивающиеся в организме плода человека, накапливаются и созревают в тонком кишечнике. Mucosal Immunol. 7 , 1233–1243 (2014).

    CAS Статья PubMed Google Scholar

  • 110

    An, D. et al. Сфинголипиды симбиотического микроба регулируют гомеостаз Т-клеток-естественных киллеров кишечника хозяина. Cell 156 , 123–133 (2014).

    CAS Статья PubMed PubMed Central Google Scholar

  • 111

    Persson, E. K., Jaensson, E. & Agace, W. W. Разнообразный онтогенез и функции дендритных клеток / макрофагов тонкого кишечника мышей. Иммунобиология 215 , 692–697 (2010).

    CAS Статья PubMed Google Scholar

  • 112

    Церович, В., Bain, C.C., Mowat, A.M. & Milling, S.W.F. Макрофаги кишечника и дендритные клетки: в чем разница? Trends Immunol. 35 , 270–277 (2014). В этом обзоре освещаются различные свойства и онтогенез кишечных ДК и макрофагов.

    CAS Статья PubMed Google Scholar

  • 113

    Ueda, Y. et al. Комменсальная микробиота вызывает гипореактивность ЛПС в макрофагах толстой кишки за счет продукции IL-10. Внутр. Иммунол. 22 , 953–962 (2010).

    CAS Статья PubMed Google Scholar

  • 114

    Melillo, J. A. et al. Специфичное для дендритных клеток (DC) нацеливание показывает, что Stat3 является негативным регулятором функции DC. J. Immunol. 184 , 2638–2645 (2010).

    CAS Статья PubMed PubMed Central Google Scholar

  • 115

    Такеда, К.и другие. Повышенная активность Th2 и развитие хронического энтероколита у мышей, лишенных Stat3 в макрофагах и нейтрофилах. Иммунитет 10 , 39–49 (1999).

    CAS Статья PubMed Google Scholar

  • 116

    Murai, M. et al. Интерлейкин 10 действует на регуляторные Т-клетки, поддерживая экспрессию фактора транскрипции Foxp3 и подавляя функцию у мышей с колитом. Nature Immunol. 10 , 1178–1184 (2009).

    CAS Статья Google Scholar

  • 117

    Hadis, U. et al. Кишечная толерантность требует самонаведения в кишечнике и экспансии FoxP3 + регуляторных Т-клеток в собственной пластинке. Иммунитет 34 , 237–246 (2011). Это исследование определяет анатомические и механические пути, которые контролируют индукцию и вторичную экспансию клеток T Reg в кишечнике.

    CAS Статья PubMed Google Scholar

  • 118

    Шоу, М.Х., Камада, Н., Ким, Ю. Г. и Нуньес, Г. Индуцированный микробиотой IL-1β, но не IL-6, имеет решающее значение для развития устойчивых клеток Th27 в кишечнике. J. Exp. Med. 209 , 251–258 (2012).

    CAS Статья PubMed PubMed Central Google Scholar

  • 119

    Zigmond, E. et al. Ограниченный макрофагами дефицит рецепторов интерлейкина-10, но не дефицит ИЛ-10, вызывает тяжелый спонтанный колит. Иммунитет 40 , 720–733 (2014).

    CAS Статья PubMed Google Scholar

  • 120

    Shouval, D. S. et al. Передача сигналов рецептора интерлейкина-10 в клетках врожденного иммунитета регулирует иммунную толерантность слизистых оболочек и противовоспалительную функцию макрофагов. Иммунитет 40 , 706–719 (2014).

    CAS Статья PubMed PubMed Central Google Scholar

  • 121

    Бейн, С.C. et al. Постоянное пополнение циркулирующими моноцитами поддерживает пул макрофагов в кишечнике взрослых мышей. Nature Immunol. http://dx.doi.org/10.1038/ni.2967 (2014).

  • 122

    Бейн, К. и Моват, А. М. Макрофаги в кишечном гомеостазе и воспалении. Immunol. Ред. 260 , 102–117 (2014).

    CAS Статья PubMed PubMed Central Google Scholar

  • 123

    Хьюм, Д.А., Перри, В. Х. и Гордон, С. Мононуклеарная фагоцитарная система мыши, определяемая иммуногистохимической локализацией антигена F4 / 80: макрофаги, связанные с эпителием. Анат. Рек. 210 , 503–512 (1984).

    CAS Статья PubMed Google Scholar

  • 124

    Нагашима, Р., Маэда, К., Имаи, Ю. и Такахаши, Т. Макрофаги собственной личности Lamina в слизистой оболочке желудочно-кишечного тракта человека: их распределение, иммуногистологический фенотип и функция. J. Histochem. Cytochem. 44 , 721–731 (1996).

    CAS Статья PubMed Google Scholar

  • 125

    Вебер Б., Заурер Л. и Мюллер С. Макрофаги кишечника: дифференциация и участие в иммунопатологии кишечника. Семин. Immunopathol. 31 , 171–184 (2009).

    CAS Статья PubMed Google Scholar

  • 126

    Огино, Т.и другие. Повышенная Th27-индуцирующая активность CD14 + CD163 low миелоидных клеток в собственной пластинке кишечника пациентов с болезнью Крона. Гастроэнтерология 145 , 1380–1391 (2013).

    CAS Статья PubMed Google Scholar

  • 127

    Hume, DA, Allan, W., Hogan, PG & Doe, WF Иммуногистохимическая характеристика макрофагов в печени и желудочно-кишечном тракте человека: экспрессия CD4, HLA-DR, OKM1 и маркера зрелых макрофагов 25F9 в норме и больная ткань. J. Leukoc. Биол. 42 , 474–484 (1987).

    CAS Статья PubMed Google Scholar

  • 128

    Махида, Ю. Р., Патель, С., Джиончетти, П., Во, Д. и Джуэлл, Д. П. Субпопуляции макрофагов в собственной пластинке нормальной и воспаленной толстой кишки и подвздошной кишки. Кишечник 30 , 826–834 (1989).

    CAS Статья PubMed PubMed Central Google Scholar

  • 129

    Ругтвейт, Дж., Brandtzaeg, P., Halstensen, T. S., Fausa, O. & Scott, H. Повышенное количество макрофагов при воспалительном заболевании кишечника: очевидный набор из моноцитов периферической крови. Кишечник 35 , 669–674 (1994).

    CAS Статья PubMed PubMed Central Google Scholar

  • 130

    Carlsen, HS, Yamanaka, T., Scott, H., Rugtveit, J. & Brandtzaeg, P. Доля макрофагов слизистой оболочки CD40 + увеличивается при воспалительном заболевании кишечника, тогда как лиганд CD40 (CD154) + Т-клетки относительно уменьшены, что предполагает дифференциальную модуляцию этих костимулирующих молекул в собственной пластинке кишечника человека. Inflamm. Кишечник. 12 , 1013–1024 (2006).

    Артикул PubMed Google Scholar

  • 131

    Devosse, T. et al. Формилпептидный рецептор-подобный 2 экспрессируется и функционирует в плазматических дендритных клетках, тканеспецифических субпопуляциях макрофагов и эозинофилах. J. Immunol. 182 , 4974–4984 (2009).

    CAS Статья PubMed Google Scholar

  • 132

    МакЭлрат, М.J. et al. Всесторонняя оценка клеток-мишеней ВИЧ в дистальном отделе кишечника человека предполагает повышение восприимчивости к ВИЧ в области заднего прохода. J. Acquir. Иммунная защита. Syndr. 63 , 263–271 (2013).

    CAS Статья Google Scholar

  • 133

    Rugtveit, J. et al. Респираторный взрыв кишечных макрофагов при воспалительном заболевании кишечника в основном вызывается клетками, происходящими из моноцитов CD14 + L1 + . Кишечник 37 , 367–373 (1995).

    CAS Статья PubMed PubMed Central Google Scholar

  • 134

    Smythies, L.E. et al. Макрофаги кишечника человека проявляют сильную воспалительную анергию, несмотря на активную фагоцитарную и бактерицидную активность. J. Clin. Вкладывать деньги. 115 , 66–75 (2005).

    CAS Статья PubMed PubMed Central Google Scholar

  • 135

    Смитис, Л.E. et al. Анергия воспаления в макрофагах кишечника человека возникает из-за индуцированной Smad экспрессии IκBα и инактивации NF-κB. J. Biol. Chem. 285 , 19593–19604 (2010).

    CAS Статья PubMed PubMed Central Google Scholar

  • 136

    Smith, P. D. et al. Макрофаги кишечника и реакция на вторжение микробов. Mucosal Immunol. 4 , 31–42 (2011).

    Артикул CAS PubMed Google Scholar

  • 137

    Богунович, М.и другие. Происхождение сети дендритных клеток lamina propria. Иммунитет 31 , 513–525 (2009).

    CAS Статья PubMed PubMed Central Google Scholar

  • 138

    Schulz, O. et al. Кишечные CD103 + , но не CX3CR1 + , клетки для отбора проб антигена мигрируют в лимфе и выполняют классические функции дендритных клеток. J. Exp. Med. 206 , 3101–3114 (2009).

    CAS Статья PubMed PubMed Central Google Scholar

  • 139

    Церович, В.и другие. Кишечные дендритные клетки CD103 мигрируют в лимфатических и первичных эффекторных Т-клетках. Mucosal Immunol. 6 , 104–113 (2013).

    CAS Статья PubMed Google Scholar

  • 140

    Перссон, Э. К., Скотт, К. Л., Моват, А. М. и Агас, В. В. Подмножества дендритных клеток в собственной пластинке кишечника: онтогенез и функция. евро. J. Immunol. 43 , 3098–3107 (2013). В этом обзоре описываются различные четко определенные подмножества кишечных ДК и то, как их состав изменяется в желудочно-кишечном тракте.

    CAS Статья PubMed PubMed Central Google Scholar

  • 141

    Эдельсон, Б. Т. и др. Периферические дендритные клетки CD103 + образуют унифицированную субпопуляцию, онтогенетически связанную с обычными дендритными клетками CD8α + . J. Exp. Med. 207 , 823–836 (2010).

    CAS Статья PubMed PubMed Central Google Scholar

  • 142

    Cerovic, V. et al. Лимфатические дендритные клетки CD8α + обладают уникальной способностью перекрестно праймировать Т-клетки CD8 + с антигеном, полученным из эпителиальных клеток кишечника. Mucosal Immunol. http://dx.doi.org/10.1038/mi.2014.40 (2014).

  • 143

    Schlitzer, A. et al. Зависящие от фактора транскрипции IRF4 дендритные клетки CD11b + у человека и мыши контролируют цитокиновые ответы IL-17 слизистой оболочки. Иммунитет 38 , 970–983 (2013).

    CAS Статья PubMed PubMed Central Google Scholar

  • 144

    Persson, E. K. et al. IRF4 зависимые от транскрипционного фактора CD103 + CD11b + дендритные клетки управляют дифференцировкой T-хелперов 17 слизистой оболочки. Иммунитет 38 , 958–969 (2013).

    CAS Статья PubMed Google Scholar

  • 145

    Пулен, Л.F. et al. DNGR-1 является специфическим и универсальным маркером Batf3-зависимых дендритных клеток мыши и человека в лимфоидных и нелимфоидных тканях. Кровь 119 , 6052–6062 (2012).

    CAS Статья PubMed Google Scholar

  • 146

    Часовщик, П. Б. и др. Сравнительное транскрипционное и функциональное профилирование определяет консервативные программы дифференцировки кишечных ДК у людей и мышей. Nature Immunol. 15 , 98–108 (2014).

    CAS Статья Google Scholar

  • 147

    Satpathy, A. T. et al. Notch3-зависимые классические дендритные клетки организуют иммунитет кишечника к прикрепляющимся и исчезающим бактериальным патогенам. Nature Immunol. 14 , 937–948 (2013).

    CAS Статья Google Scholar

  • 148

    Велти, Н. Э. и др.Дендритные клетки собственной пластинки кишечника поддерживают гомеостаз Т-клеток, но не влияют на комменсализм. J. Exp. Med. 210 , 2011–2024 (2013).

    CAS Статья PubMed PubMed Central Google Scholar

  • 149

    Wendland, M. et al. CCR9 — это рецептор самонаведения для плазмоцитоидных дендритных клеток тонкого кишечника. Proc. Natl Acad. Sci. США 104 , 6347–6352 (2007).

    CAS Статья PubMed Google Scholar

  • 150

    Баумгарт, Д.C. et al. Аберрантное распределение и функция плазмоцитоидных дендритных клеток у пациентов с болезнью Крона и язвенным колитом. Clin. Exp. Иммунол. 166 , 46–54 (2011).

    CAS Статья PubMed PubMed Central Google Scholar

  • 151

    Kwa, S. et al. Плазмацитоидные дендритные клетки привлекаются к ободочной кишке и способствуют активации иммунной системы во время патогенной инфекции SIV у макак-резусов. Кровь 118 , 2763–2773 (2011).

    CAS Статья PubMed PubMed Central Google Scholar

  • 152

    Смит, Дж. Дж. И др. Роль субпопуляций дендритных клеток кишечника в возникновении пищевой аллергии. Clin. Exp. Аллергия 41 , 890–898 (2011).

    CAS Статья PubMed Google Scholar

  • 153

    Мизуно, С.и другие. Плазмацитоидные дендритные клетки CCR9 + в тонком кишечнике подавляют развитие воспаления кишечника у мышей. Immunol. Lett. 146 , 64–69 (2012).

    CAS Статья PubMed Google Scholar

  • 154

    Karlis, J. et al. Характеристика субпопуляций дендритных клеток толстой кишки и брыжеечных лимфатических узлов в модели адоптивного переноса воспалительного заболевания кишечника у мышей. Inflamm.Кишечник. 10 , 834–847 (2004).

    Артикул PubMed Google Scholar

  • 155

    Yrlid, U. et al. Плазмацитоидные дендритные клетки не мигрируют в кишечной или печеночной лимфе. J. Immunol. 177 , 6115–6121 (2006).

    CAS Статья PubMed Google Scholar

  • 156

    Дасгупта, С., Эртурк-Хасдемир, Д., Очоа-Репараз, Дж., Reinecker, H.C. & Kasper, D.L. Плазмацитоидные дендритные клетки опосредуют противовоспалительные реакции на кишечную комменсальную молекулу через врожденные и адаптивные механизмы. Cell Host Microbe 15 , 413–423 (2014).

    CAS Статья PubMed PubMed Central Google Scholar

  • 157

    Роткоттер, Х. Дж., Кирхгофф, Т. и Пабст, Р. Лимфоидные и нелимфоидные клетки эпителия и собственной пластинки слизистой оболочки кишечника свиней. Кишечник 35 , 1582–1589 (1994).

    CAS Статья PubMed PubMed Central Google Scholar

  • 158

    Bischoff, S.C. et al. Количественная оценка кишечных эозинофилов и тучных клеток при воспалительном заболевании кишечника. Гистопатология 28 , 1–13 (1996).

    CAS Статья PubMed Google Scholar

  • 159

    Ротенберг, М.Э., Мишра, А., Брандт, Э. Б. и Хоган, С. П. Эозинофилы желудочно-кишечного тракта. Immunol. Ред. 179 , 139–155 (2001).

    CAS Статья PubMed Google Scholar

  • 160

    Bain, C.C. et al. Резидентные и провоспалительные макрофаги в толстой кишке представляют собой альтернативные контекстно-зависимые судьбы одних и тех же предшественников моноцитов Ly6C hi . Mucosal Immunol. 6 , 498–510 (2013).

    CAS Статья PubMed Google Scholar

  • 161

    Бишофф, С. С. Физиологические и патофизиологические функции тучных клеток кишечника. Семин. Immunopathol. 31 , 185–205 (2009).

    CAS Статья PubMed Google Scholar

  • 162

    Ю., Л. К. и Пердью, М. Х. Роль тучных клеток в функции слизистой оболочки кишечника: исследования на моделях гиперчувствительности и стресса. Immunol. Ред. 179 , 61–73 (2001).

    CAS Статья PubMed Google Scholar

  • 163

    Carlens, J. et al. Общие сигналы, зависящие от γ-цепи, обеспечивают избирательное выживание эозинофилов в тонком кишечнике мышей. J. Immunol. 183 , 5600–5607 (2009).

    CAS Статья PubMed Google Scholar

  • 164

    Штрауманн, А.и другие. Экспрессия цитокинов в здоровой и воспаленной слизистой оболочке: исследование роли эозинофилов в пищеварительном тракте. Inflamm. Кишечник. 11 , 720–726 (2005).

    Артикул PubMed Google Scholar

  • 165

    Мишра А., Хоган С. П., Ли, Дж. Дж., Фостер, П. С. и Ротенберг, М. Е. Основные сигналы, которые регулируют возвращение эозинофилов в желудочно-кишечный тракт. J. Clin. Вкладывать деньги. 103 , 1719–1727 (1999).

    CAS Статья PubMed PubMed Central Google Scholar

  • 166

    Ahrens, R. et al. Кишечные макрофаги / происходящие из эпителиальных клеток CCL11 / эотаксин-1 опосредуют рекрутирование и функцию эозинофилов при язвенном колите у детей. J. Immunol. 181 , 7390–7399 (2008).

    CAS Статья PubMed PubMed Central Google Scholar

  • 167

    Лампинен, М., Уодделл А., Аренс Р., Карлсон М. и Хоган С. П. CD14 + CD33 + сигнатура миелоидных клеток – CCL11 – эозинофилов при язвенном колите. J. Leukoc. Биол. 94 , 1061–1070 (2013).

    CAS Статья PubMed PubMed Central Google Scholar

  • 168

    Brandt, E. B. et al. Интегрин α4bβ7 динамически экспрессируется на мышиных эозинофилах и участвует в доставке эозинофилов в кишечник. Clin. Exp. Аллергия 36 , 543–553 (2006).

    CAS Статья PubMed Google Scholar

  • 169

    Wen, T. et al. Маркер CD22 пан-В-клеток экспрессируется на эозинофилах желудочно-кишечного тракта и отрицательно регулирует тканевую эозинофилию. J. Immunol. 188 , 1075–1082 (2012).

    CAS Статья PubMed Google Scholar

  • 170

    Чу, В.T. et al. Эозинофилы способствуют образованию и поддержанию плазматических клеток, экспрессирующих иммуноглобулин-А, и вносят вклад в иммунный гомеостаз кишечника. Иммунитет 40 , 582–593 (2014). Это исследование предоставляет новую информацию о потенциальных функциях кишечных эозинофилов.

    CAS Статья PubMed Google Scholar

  • 171

    Дворжак, А.М., Монахан, Р.А., Осейдж, Дж. Э. и Дикерсин, Г.Болезнь Р. Крона: исследования с помощью просвечивающей электронной микроскопии. II. Иммунологический воспалительный ответ. Изменения тучных клеток, базофилов, эозинофилов и микрососудов. Hum. Патол. 11 , 606–619 (1980).

    CAS Статья PubMed Google Scholar

  • 172

    Штробель, С., Миллер, Х. Р. и Фергюсон, А. Тучные клетки слизистой оболочки кишечника человека: оценка методов фиксации и окрашивания. J. Clin. Патол. 34 , 851–858 (1981).

    CAS Статья PubMed PubMed Central Google Scholar

  • 173

    Nishida, Y. et al. Различное распределение тучных клеток и макрофагов в слизистой оболочке толстой кишки у пациентов с коллагенозным колитом и воспалительным заболеванием кишечника. Гепатогастроэнтерология 49 , 678–682 (2002).

    PubMed Google Scholar

  • 174

    Ллойд, Г., Грин, Ф. Х., Фокс, Х., Мани, В. и Тернберг, Л. А. Тучные клетки и иммуноглобулин Е при воспалительном заболевании кишечника. Кишечник 16 , 861–865 (1975).

    CAS Статья PubMed PubMed Central Google Scholar

  • 175

    Миллер, Х. Р. и Пембертон, А. Д. Тканеспецифическая экспрессия сериновых протеиназ гранул тучных клеток и их роль в воспалении в легких и кишечнике. Иммунология 105 , 375–390 (2002).

    CAS Статья PubMed PubMed Central Google Scholar

  • 176

    Миллер, Х. Р. и др. Гранулярные протеиназы определяют гетерогенность тучных клеток в серозной оболочке и слизистой оболочке желудочно-кишечного тракта мыши. Иммунология 65 , 559–566 (1988).

    CAS PubMed PubMed Central Google Scholar

  • 177

    Kunkel, E.J. et al.Хемокиновый рецептор 9 CC лимфоцитов и экспрессия хемокинов, экспрессируемых эпителиальным тимусом (TECK), различают иммунный компартмент тонкого кишечника: эпителиальная экспрессия тканеспецифичных хемокинов как организующий принцип регионального иммунитета. J. Exp. Med. 192 , 761–768 (2000).

    CAS Статья PubMed PubMed Central Google Scholar

  • 178

    Pabst, O. et al. Хемокиновый рецептор CCR9 способствует локализации плазматических клеток в тонком кишечнике. J. Exp. Med. 199 , 411–416 (2004).

    CAS Статья PubMed PubMed Central Google Scholar

  • 179

    Свенссон, М. и др. CCL25 опосредует локализацию недавно активированных лимфоцитов CD8αβ + на слизистой оболочке тонкой кишки. J. Clin. Вкладывать деньги. 110 , 1113–1121 (2002).

    CAS Статья PubMed PubMed Central Google Scholar

  • 180

    Фенг, Н.и другие. Избыточная роль хемокинов CCL25 / TECK и CCL28 / MEC в привлечении плазмобластов IgA + в собственную пластинку кишечника после ротавирусной инфекции. J. Immunol. 176 , 5749–5759 (2006).

    CAS Статья PubMed Google Scholar

  • 181

    Hieshima, K. et al. Хемокиновые лиганды СС 25 и 28 играют важную роль в кишечной экстравазации клеток, секретирующих антитела IgA. Дж.Иммунол. 173 , 3668–3675 (2004).

    CAS Статья PubMed Google Scholar

  • 182

    Ху, С., Янг, К., Янг, Дж., Ли, М. и Сюн, Н. Критические роли хемокинового рецептора CCR10 в регуляции ответов IgA памяти в кишечнике. Proc. Natl Acad. Sci. США 108 , E1035 – E1044 (2011).

    Артикул PubMed Google Scholar

  • 183

    Ким, С.V. et al. GPR15-опосредованный хоминг контролирует иммунный гомеостаз в слизистой оболочке толстой кишки. Наука 340 , 1456–1459 (2013). В этой статье описан новый хемоаттрактант, специфичный для толстой кишки.

    CAS Статья PubMed PubMed Central Google Scholar

  • 184

    Agace, W. W. и Persson, E. K. Как метаболизирующие витамин A дендритные клетки образуются в слизистой оболочке кишечника. Trends Immunol. 33 , 42–48 (2012).

    CAS Статья PubMed Google Scholar

  • 185

    Spencer, S.P. et al. Адаптация врожденных лимфоидных клеток к дефициту питательных микроэлементов способствует развитию барьерного иммунитета 2 типа. Наука 343 , 432–437 (2014).

    CAS Статья PubMed PubMed Central Google Scholar

  • 186

    Jaensson-Gyllenback, E.и другие. Желчные ретиноиды отпечатывают дендритные клетки CD103 + кишечника со способностью генерировать кишечные Т-клетки. Mucosal Immunol. 4 , 438–447 (2011).

    CAS Статья PubMed PubMed Central Google Scholar

  • 187

    Вонг, Дж. М., де Соуза, Р., Кендалл, К. В., Эмам, А. и Дженкинс, Д. Дж. Здоровье толстой кишки: ферментация и короткоцепочечные жирные кислоты. J. Clin. Гастроэнтерол. 40 , 235–243 (2006).

    CAS Статья PubMed Google Scholar

  • 188

    Мересс, Б., Маламут, Г. и Серф-Бенсуссан, Н. Целиакия: иммунологическая головоломка. Иммунитет 36 , 907–919 (2012).

    CAS Статья PubMed Google Scholar

  • 189

    Найтс, Д., Лассен, К. Г. и Ксавьер, Р. Дж. Достижения в патогенезе воспалительных заболеваний кишечника: связь генетики хозяина и микробиома. Кишечник 62 , 1505–1510 (2013). В этой статье сообщается, что корреляция генетической основы болезни Крона и иммунных реакций на микробы может помочь объяснить ее анатомическую локализацию.

    CAS Статья PubMed Google Scholar

  • 190

    Kaser, A., Zeissig, S. & Blumberg, R. S. Воспалительное заболевание кишечника. Annu. Rev. Immunol. 28 , 573–621 (2010).

    CAS Статья PubMed PubMed Central Google Scholar

  • 191

    Дойринг, Дж.J. et al. Геномный стресс ATG16L1 с ограничением аллеля ER-клеток Панета при болезни Крона в состоянии покоя Кишечник 63 , 1081–1091 (2013).

    Артикул CAS PubMed Google Scholar

  • 192

    Jostins, L. et al. Взаимодействия «хозяин-микроб» сформировали генетическую архитектуру воспалительного заболевания кишечника. Природа 491 , 119–124 (2012).

    CAS Статья PubMed PubMed Central Google Scholar

  • 193

    Равердо, М.И Миллс, К. Х. Модуляция Т-клеточного и врожденного иммунного ответа ретиноевой кислотой. J. Immunol. 192 , 2953–2958 (2014).

    CAS Статья PubMed Google Scholar

  • 194

    Wehkamp, ​​J. et al. Снижение уровня α-дефензинов клеток Панета при болезни Крона подвздошной кишки. Proc. Natl Acad. Sci. США 102 , 18129–18134 (2005).

    CAS Статья PubMed Google Scholar

  • 195

    Wehkamp, ​​J., Schmid, M. & Stange, E. F. Дефенсины и другие антимикробные пептиды при воспалительном заболевании кишечника. Curr. Opin. Гастроэнтерол. 23 , 370–378 (2007).

    CAS Статья PubMed Google Scholar

  • 196

    Becker, C. et al. Активация конститутивного промотора p40 и продукция IL-23 в терминальном отделе подвздошной кишки опосредуются дендритными клетками. J. Clin. Вкладывать деньги. 112 , 693–706 (2003).

    CAS Статья PubMed PubMed Central Google Scholar

  • 197

    Малой, К. Дж. И Паури, Ф. Кишечный гомеостаз и его нарушение при воспалительном заболевании кишечника. Природа 474 , 298–306 (2011).

    CAS Статья PubMed Google Scholar

  • 198

    Chassaing, B. & Darfeuille-Michaud, A. Комменсальная микробиота и энтеропатогены в патогенезе воспалительных заболеваний кишечника. Гастроэнтерология 140 , 1720–1728 (2011).

    Артикул PubMed Google Scholar

  • 199

    Nguyen, H. T. et al. Связанные с болезнью Крона адгезивные инвазивные бактерии Escherichia coli модулируют уровни микроРНК в эпителиальных клетках кишечника для снижения аутофагии. Гастроэнтерология 146 , 508–519 (2014).

    CAS Статья PubMed Google Scholar

  • 200

    Уоллес, К.Л., Чжэн, Л. Б., Канадзава, Ю. и Ши, Д. К. Иммунопатология воспалительного заболевания кишечника. World J. Gastroenterol. 20 , 6–21 (2014).

    CAS Статья PubMed PubMed Central Google Scholar

  • 201

    Паркес М. Вселенная генетики болезни Крона и язвенного колита. Dig. Дис. 30 (Приложение 1), 78–81 (2012). В этой статье генетическая основа ВЗК человека сравнивается с дискретными анатомическими предпочтениями.

    Артикул PubMed Google Scholar

  • 202

    Нейрат, М. Ф., Финотто, С. и Глимчер, Л. Х. Роль поляризации Th2 / Th3 в иммунитете слизистой оболочки. Nature Med. 8 , 567–573 (2002).

    CAS Статья PubMed Google Scholar

  • 203

    Biancheri, P. et al. Отсутствие роли интерлейкина-13 в воспалительном заболевании кишечника. евро. J. Immunol. 44 , 370–385 (2014).

    CAS Статья PubMed Google Scholar

  • 204

    Стробер В., Фасс И. Дж. И Блумберг Р. С. Иммунология моделей воспаления слизистой оболочки. Annu. Rev. Immunol. 20 , 495–549 (2002).

    CAS Статья PubMed Google Scholar

  • 205

    Нейрат, М.F. Модели воспалительных заболеваний кишечника на животных: выяснение патогенеза колита, илеита и рака. Dig. Дис. 30 (Приложение 1), 91–94 (2012).

    Артикул PubMed Google Scholar

  • 206

    Рубцов Ю.П. и др. Интерлейкин-10, производный от регуляторных Т-клеток, ограничивает воспаление на границе раздела сред. Иммунитет 28 , 546–558 (2008).

    CAS Статья PubMed Google Scholar

  • 207

    Салех, М.И Элсон, С.О. Экспериментальное воспалительное заболевание кишечника: понимание диалога между хозяином и микробиотой. Иммунитет 34 , 293–302 (2011).

    CAS Статья PubMed PubMed Central Google Scholar

  • 208

    Fuss, I.J. et al. Неклассические CD1d-ограниченные NK T-клетки, которые продуцируют IL-13, характеризуют атипичный ответ Th3 при язвенном колите. J. Clin. Вкладывать деньги. 113 , 1490–1497 (2004).

    CAS Статья PubMed PubMed Central Google Scholar

  • 209

    Heller, F., Fuss, I.J., Nieuwenhuis, E. E., Blumberg, R. S. и Strober, W. Оксазолоновый колит, модель Th3-колита, напоминающая язвенный колит, опосредуется продуцирующими IL-13 NK-T-клетками. Иммунитет 17 , 629–638 (2002).

    CAS Статья PubMed Google Scholar

  • 210

    Кун, Р., Lohler, J., Rennick, D., Rajewsky, K. & Muller, W. У мышей с дефицитом интерлейкина-10 развивается хронический энтероколит. Cell 75 , 263–279 (1993).

    CAS Статья PubMed Google Scholar

  • 211

    Glocker, E.O. et al. Воспалительное заболевание кишечника и мутации, влияющие на рецептор интерлейкина-10. N. Engl. J. Med. 361 , 2033–2045 (2009).

    CAS Статья PubMed PubMed Central Google Scholar

  • 212

    Контояннис, Д., Паспаракис, М., Писарро, Т. Т., Коминелли, Ф. и Коллиас, Г. Нарушение включения / выключения регуляции биосинтеза TNF у мышей, лишенных элементов, богатых TNF AU: последствия для иммунопатологий суставов и кишечника. Иммунитет 10 , 387–398 (1999). В этой статье описывается одна из немногих экспериментальных моделей ВЗК, поражающих тонкий кишечник.

    CAS Статья PubMed Google Scholar

  • 213

    Мацумото, С.и другие. Воспалительные заболевания кишечника, подобные энтериту и цециту, у мышей линии P1 / Yit с ускоренным старением. Кишечник 43 , 71–78 (1998).

    CAS Статья PubMed PubMed Central Google Scholar

  • 214

    Marini, M. et al. Нейтрализация TNF-α уменьшает тяжесть мышиного Крона-подобного илеита за счет отмены апоптоза кишечных эпителиальных клеток. Proc. Natl Acad. Sci. США 100 , 8366–8371 (2003).

    CAS Статья PubMed Google Scholar

  • 215

    McNamee, E. N. et al. Новая модель Th3-поляризованного хронического илеита: мышь SAMP1. Inflamm. Кишечник. 16 , 743–752 (2010).

    Артикул PubMed PubMed Central Google Scholar

  • 216

    Han, D. et al. Экспрессия дендритными клетками сигнальной молекулы TRAF6 имеет решающее значение для иммунной толерантности кишечника, зависимой от микробиоты. Иммунитет 38 , 1211–1222 (2013).

    CAS Статья PubMed PubMed Central Google Scholar

  • 217

    Трэвис М.А. и др. Потеря интегрина αvβ8 дендритными клетками вызывает аутоиммунитет и колит у мышей. Природа 449 , 361–365 (2007).

    CAS Статья PubMed PubMed Central Google Scholar

  • 218

    Пайдасси, Х.и другие. Предпочтительная экспрессия интегрина αvβ8 способствует образованию регуляторных Т-клеток дендритными клетками CD103 + мыши. Гастроэнтерология 141 , 1813–1820 (2011).

    CAS Статья PubMed PubMed Central Google Scholar

  • 219

    Пальма, Г. Д. и др. Влияние типа кормления грудью и генетического риска развития целиакии на кишечную микробиоту младенцев: исследование PROFICEL. PLoS ONE 7 , e30791 (2012).

    Артикул CAS PubMed PubMed Central Google Scholar

  • 220

    Sellitto, M. et al. Доказательство концепции анализа микробиома-метаболома и отсроченного воздействия глютена на аутоиммунитет целиакии у младенцев с генетической группой риска. PLoS ONE 7 , e33387 (2012).

    CAS Статья PubMed PubMed Central Google Scholar

  • 221

    Оу, Г.и другие. Микробиота проксимального отдела тонкой кишки и идентификация палочковидных бактерий, связанных с детской глютеновой болезнью. г. J. Gastroenterol. 104 , 3058–3067 (2009).

    Артикул PubMed Google Scholar

  • 222

    Sjoberg, V. et al. Ответы кишечных Т-клеток при глютеновой болезни — влияние бактерий, связанных с глютеновой болезнью. PLoS ONE 8 , e53414 (2013).

    Артикул CAS PubMed PubMed Central Google Scholar

  • 223

    Билимория, К.Y. et al. Рак тонкой кишки в США: изменения в эпидемиологии, лечении и выживаемости за последние 20 лет. Ann. Surg. 249 , 63–71 (2009).

    Артикул PubMed Google Scholar

  • 224

    Американское онкологическое общество. Рак в фактах и ​​цифрах, 2013 г. Американское онкологическое общество [онлайн] (2013 г.).

  • 225

    О’Киф, С. Дж. Питание и здоровье толстой кишки: критическая роль микробиоты. Curr. Opin. Гастроэнтерол. 24 , 51–58 (2008).

    Артикул PubMed Google Scholar

  • 226

    Bongers, G. et al. Взаимодействие микробиоты хозяина, генетических нарушений и воспаления способствует локальному развитию новообразований кишечника у мышей. J. Exp. Med. 211 , 457–472 (2014).

    CAS Статья PubMed PubMed Central Google Scholar

  • 227

    Хубер, С.и другие. IL-22BP регулируется инфламмасомой и модулирует онкогенез в кишечнике. Природа 491 , 259–263 (2012).

    CAS Статья PubMed PubMed Central Google Scholar

  • 228

    Martin, J. C. et al. Связывающий интерлейкин-22 белок (IL-22BP) конститутивно экспрессируется подмножеством обычных дендритных клеток и сильно индуцируется ретиноевой кислотой. Mucosal Immunol. 7 , 101–113 (2014).

    CAS Статья PubMed Google Scholar

  • 229

    Jang, M.H. et al. М-клетки ворсинок кишечника: место проникновения антигена в эпителий слизистой оболочки. Proc. Natl Acad. Sci. США 101 , 6110–6115 (2004).

    CAS Статья PubMed Google Scholar

  • 230

    Rescigno, M. et al. Дендритные клетки экспрессируют белки с плотными контактами и проникают в монослои эпителия кишечника, чтобы взять образцы бактерий. Nature Immunol. 2 , 361–367 (2001).

    CAS Статья Google Scholar

  • 231

    Niess, J. H. et al. CX3CR1-опосредованный доступ дендритных клеток к просвету кишечника и бактериальный клиренс. Наука 307 , 254–258 (2005).

    CAS Статья PubMed Google Scholar

  • 232

    Chieppa, M., Rescigno, M., Хуанг, А. Ю. и Жермен, Р. Н. Динамическая визуализация расширения дендритных клеток в просвет тонкой кишки в ответ на включение TLR эпителиальных клеток. J. Exp. Med. 203 , 2841–2852 (2006).

    CAS Статья PubMed PubMed Central Google Scholar

  • 233

    Arques, J. L. et al. Salmonella индуцирует зависимую от флагеллина и MyD88 миграцию дендритных клеток, улавливающих бактерии, в просвет кишечника. Гастроэнтерология 137 , 579–587, 587 e1-2 (2009).

    Артикул PubMed Google Scholar

  • 234

    Farache, J. et al. Люминальные бактерии привлекают дендритные клетки CD103 + в эпителий кишечника для отбора бактериальных антигенов для презентации. Иммунитет 38 , 581–595 (2013).

    CAS Статья PubMed PubMed Central Google Scholar

  • 235

    МакДоул, Дж.R. et al. Бокаловидные клетки доставляют люминальный антиген к дендритным клеткам CD103 + в тонком кишечнике. Природа 483 , 345–349 (2012). Это современное исследование с использованием изображений in vivo , которое показывает, как антиген может получить доступ через бокаловидные клетки к DC в тонком кишечнике, но не в толстой кишке.

    CAS Статья PubMed PubMed Central Google Scholar

  • 236

    Йошида, М.и другие. Неонатальный рецептор Fc человека опосредует транспорт IgG в секреты просвета для доставки антигенов к дендритным клеткам слизистой оболочки. Иммунитет 20 , 769–783 (2004).

    CAS Статья PubMed Google Scholar

  • 237

    Mazzini, E., Massimiliano, L., Penna, G. & Rescigno, M. Оральная толерантность может быть установлена ​​путем переноса антигенов, скармливаемых через щелевые соединения, от макрофагов CX3CR1 + дендритным клеткам CD103 + . Иммунитет 40 , 248–261 (2014).

    CAS Статья PubMed Google Scholar

  • 238

    Arijs, I. et al. Экспрессия генов слизистой оболочки молекул клеточной адгезии, хемокинов и хемокиновых рецепторов у пациентов с воспалительным заболеванием кишечника до и после лечения инфликсимабом. г. J. Gastroenterol. 106 , 748–761 (2011).

    CAS Статья PubMed Google Scholar

  • 239

    Пападакис, К.A. et al. CCR9-положительные лимфоциты и хемокины, экспрессируемые в тимусе, отличают тонкую кишку от болезни Крона толстой кишки. Гастроэнтерология 121 , 246–254 (2001).

    CAS Статья PubMed Google Scholar

  • 240

    Johansson-Lindbom, B. et al. Селективная генерация кишечных тропических Т-клеток в кишечной лимфоидной ткани (GALT): потребность в дендритных клетках GALT и адъюванте. J. Exp. Med. 198 , 963–969 (2003).

    CAS Статья PubMed PubMed Central Google Scholar

  • 241

    Lindner, C. et al. Возраст, микробиота и Т-клетки формируют различные индивидуальные репертуары IgA в кишечнике. J. Exp. Med. 209 , 365–377 (2012).

    CAS Статья PubMed PubMed Central Google Scholar

  • 242

    Stenstad, H., Svensson, M., Cucak, H., Kotarsky, K. & Agace, W. W. Дифференциальные механизмы хоминга регулируют регионализированное накопление эффекторных CD8αβ + Т-клеток в тонком кишечнике. Proc. Natl Acad. Sci. США 104 , 10122–10127 (2007). Это подробное исследование определяет, как CCL25 контролирует перемещение Т-клеток в тонкий кишечник, но не в толстую кишку, а также описывает различия внутри самого тонкого кишечника.

    CAS Статья PubMed Google Scholar

  • 243

    Пан, Дж.и другие. Новый хемокиновый лиганд для CCR10 и CCR3, экспрессируемых эпителиальными клетками в тканях слизистой оболочки. J. Immunol. 165 , 2943–2949 (2000).

    CAS Статья PubMed Google Scholar

  • 244

    Kunkel, E.J. et al. Экспрессия CCR10 является общим признаком циркулирующих и секретирующих IgA клеток эпителиальной ткани слизистой оболочки. J. Clin. Вкладывать деньги. 111 , 1001–1010 (2003).

    CAS Статья PubMed PubMed Central Google Scholar

  • 245

    Кук Д.N. et al. CCR6 опосредует локализацию дендритных клеток, гомеостаз лимфоцитов и иммунные ответы в ткани слизистой оболочки. Иммунитет 12 , 495–503 (2000).

    CAS Статья PubMed Google Scholar

  • 246

    Ивасаки, А. и Келсалл, Б. Л. Локализация отдельных подмножеств дендритных клеток пейеровских бляшек и их рекрутирование хемокинами, макрофагальным воспалительным белком (MIP) -3α, MIP-3β и хемокином вторичных лимфоидных органов. J. Exp. Med. 191 , 1381–1394 (2000).

    CAS Статья PubMed PubMed Central Google Scholar

  • 247

    Ван, К., Кан, С. Г., Ли, Дж., Сан, З. и Ким, К. Х. Роль CCR6 в миграции клеток Th27 и регуляции баланса эффекторных Т-клеток в кишечнике. Mucosal Immunol. 2 , 173–183 (2009).

    CAS Статья PubMed PubMed Central Google Scholar

  • 248

    Китамура, К., Фарбер, Дж. М. и Келсалл, Б. Л. CCR6 маркирует регуляторные Т-клетки как толстокишечный фенотип, продуцирующий ИЛ-10. J. Immunol. 185 , 3295–3304 (2010).

    CAS Статья PubMed PubMed Central Google Scholar

  • 249

    Салазар-Гонсалес, Р. М. и др. CCR6-опосредованная активация дендритными клетками патоген-специфических Т-клеток в пейеровых бляшках. Иммунитет 24 , 623–632 (2006).

    CAS Статья PubMed PubMed Central Google Scholar

  • 250

    McDonald, K.G. et al. Экспрессия рецептора 6 СС хемокина В-лимфоцитами важна для развития изолированных лимфоидных фолликулов. г. J. Pathol. 170 , 1229–1240 (2007).

    CAS Статья PubMed PubMed Central Google Scholar

  • 251

    Варона, р.и другие. CCR6-дефицитные мыши имеют нарушенный гомеостаз лейкоцитов и измененную контактную гиперчувствительность и реакции гиперчувствительности замедленного типа. J. Clin. Вкладывать деньги. 107 , R37 – R45 (2001).

    CAS Статья PubMed PubMed Central Google Scholar

  • 252

    Zhao, X. et al. CCL9 секретируется фолликул-ассоциированным эпителием и рекрутирует дендритные клетки CD11b + области купола пейеровского участка. J. Immunol. 171 , 2797–2803 (2003).

    CAS Статья PubMed Google Scholar

  • 253

    Cha, H. R. et al. Подавление Th27-клеток в тонком кишечнике за счет нарушения кишечной флоры в отсутствие ретиноевой кислоты. J. Immunol. 184 , 6799–6806 (2010).

    CAS Статья PubMed Google Scholar

  • 254

    Чанг, С.Y. et al. Недостаток ретиноевой кислоты приводит к увеличению количества дендритных клеток, экспрессирующих лангерин, в лимфоидных тканях, связанных с кишечником. Гастроэнтерология 138 , 1468–1478, 1478 e1-6 (2010).

    CAS Статья PubMed Google Scholar

  • 255

    Coombes, J. L. et al. Функционально специализированная популяция CD103 + DC слизистой оболочки индуцирует Foxp3 + регуляторные Т-клетки посредством TGF-β и механизма, зависимого от ретиноевой кислоты. J. Exp. Med. 204 , 1757–1764 (2007).

    CAS Статья PubMed PubMed Central Google Scholar

  • 256

    Iwata, M. et al. Ретиноевая кислота накладывает отпечаток специфичности на Т-лимфоциты по отношению к кишечнику. Иммунитет 21 , 527–538 (2004).

    CAS Статья PubMed Google Scholar

  • 257

    Klebanoff, C.A. et al.Ретиноевая кислота контролирует гомеостаз дендритных клеток селезенки и кишечника, полученных из пре-кДК. J. Exp. Med. 210 , 1961–1976 (2013).

    CAS Статья PubMed PubMed Central Google Scholar

  • 258

    Mora, J. R. et al. Генерация кишечных IgA-секретирующих B-клеток дендритными клетками кишечника. Наука 314 , 1157–1160 (2006).

    CAS Статья PubMed Google Scholar

  • 259

    Мора, Дж.Р., Ивата, М. и фон Андриан, У. Х. Влияние витаминов на иммунную систему: витамины A и D занимают центральное место. Nature Rev. Immunol. 8 , 685–698 (2008).

    CAS Статья Google Scholar

  • 260

    Mucida, D. et al. Реципрокная дифференцировка Th27 и регуляторных Т-клеток, опосредованная ретиноевой кислотой. Наука 317 , 256–260 (2007).

    CAS Статья PubMed Google Scholar

  • 261

    Вс, К.M. et al. Дендритные клетки собственной пластинки тонкой кишки способствуют образованию de novo reg-клеток Foxp3 через ретиноевую кислоту. J. Exp. Med. 204 , 1775–1785 (2007).

    CAS Статья PubMed PubMed Central Google Scholar

  • 262

    Suzuki, K. et al. Чувство стимулов окружающей среды фолликулярными дендритными клетками способствует образованию иммуноглобулина А в кишечнике. Иммунитет 33 , 71–83 (2010).

    CAS Статья PubMed Google Scholar

  • 263

    Такахаши, Х. и др. TGF-β и ретиноевая кислота индуцируют микроРНК miR-10a, которая нацелена на Bcl-6 и ограничивает пластичность хелперных Т-клеток. Nature Immunol. 13 , 587–595 (2012).

    CAS Статья Google Scholar

  • 264

    Hammerschmidt, S. I. et al. Клетки стромальных брыжеечных лимфатических узлов необходимы для генерации Т-лимфоцитов in vivo , возвращающихся к кишечнику. J. Exp. Med. 205 , 2483–2490 (2008).

    CAS Статья PubMed PubMed Central Google Scholar

  • 265

    Molenaar, R. et al. Экспрессия ферментов ретинальдегиддегидрогеназы в дендритных клетках слизистой оболочки и стромальных клетках лимфатических узлов, дренирующих кишечник, контролируется диетическим витамином А. J. Immunol. 186 , 1934–1942 (2011).

    CAS Статья PubMed Google Scholar

  • 266

    Поцелуй, Э.А. и Дифенбах А. Роль арилуглеводородного рецептора в контроле поддерживающих и функциональных программ RORγt + врожденных лимфоидных клеток и интраэпителиальных лимфоцитов. Фронт. Иммунол. 3 , 124 (2012).

    Артикул PubMed PubMed Central Google Scholar

  • 267

    Вельдхоен, М. и Бруклахер-Вальдерт, В. Влияние диеты на иммунитет кишечника. Nature Rev. Immunol. 12 , 696–708 (2012). В этом обзоре обсуждается влияние лигандов AHR и других пищевых компонентов на функцию иммунных клеток кишечника.

    CAS Статья Google Scholar

  • 268

    Lee, J. S. et al. AHR управляет развитием клеток ILC22 кишечника и постнатальных лимфоидных тканей посредством путей, зависящих от Notch и независимых от них. Nature Immunol. 13 , 144–151 (2012).

    CAS Статья Google Scholar

  • 269

    Qiu, J. et al. Рецептор арилуглеводородов регулирует иммунитет кишечника путем модуляции врожденных лимфоидных клеток. Иммунитет 36 , 92–104 (2012).

    CAS Статья PubMed Google Scholar

  • 270

    Li, Y. et al. Экзогенные стимулы поддерживают интраэпителиальные лимфоциты за счет активации рецепторов арилуглеводородов. Cell 147 , 629–640 (2011).

    CAS Статья PubMed Google Scholar

  • 271

    MacDonald, T. и Carter, P. B. Необходимость бактериальной флоры до того, как мыши генерируют клетки, способные опосредовать реакцию DTH на эритроциты барана. J. Immunol. 122 , 2624–2629 (1979).

    CAS PubMed Google Scholar

  • 272

    Талхам, Г.L., Jiang, H.Q., Bos, N. A. и Cebra, J. J. Сегментированные нитчатые бактерии являются мощными стимулами физиологически нормального состояния иммунной системы слизистой оболочки кишечника мыши. Заражение. Иммун. 67 , 1992–2000 (1999).

    CAS PubMed PubMed Central Google Scholar

  • 273

    Иванов И.И. и др. Индукция кишечных клеток Th27 сегментированными нитчатыми бактериями. Cell 139 , 485–498 (2009).

    CAS Статья PubMed PubMed Central Google Scholar

  • 274

    Goto, Y. et al. Сегментированные антигены нитчатых бактерий, представленные дендритными клетками кишечника, управляют дифференцировкой клеток Th27 слизистой оболочки. Иммунитет 40 , 594–607 (2014).

    CAS Статья PubMed PubMed Central Google Scholar

  • 275

    Зеланте, Т.и другие. Катаболиты триптофана из микробиоты взаимодействуют с рецепторами арилуглеводородов и уравновешивают реактивность слизистой оболочки через интерлейкин-22. Иммунитет 39 , 372–385 (2013).

    CAS Статья PubMed Google Scholar

  • 276

    Atarashi, K. et al. Индукция Treg рационально подобранной смесью штаммов Clostridia из микробиоты человека. Природа 500 , 232–236 (2013). Это исследование описывает присутствие бактерий в толстой кишке человека, которые стимулируют селективную генерацию клеток T Reg .

    CAS Статья PubMed Google Scholar

  • 277

    Atarashi, K. et al. Индукция регуляторных Т-клеток толстой кишки аборигенными видами Clostridium . Наука 331 , 337–341 (2011).

    CAS Статья PubMed Google Scholar

  • 278

    Round, J. L. & Mazmanian, S. K. Индуцибельное развитие регулирующих Т-клеток Foxp3 + комменсальной бактерией кишечной микробиоты. Proc. Natl Acad. Sci. США 107 , 12204–12209 (2010).

    CAS Статья PubMed Google Scholar

  • 279

    Furusawa, Y. et al. Бутират комменсального микроба индуцирует дифференцировку регуляторных Т-клеток толстой кишки. Природа 504 , 446–450 (2013).

    CAS Статья PubMed Google Scholar

  • 280

    Арпая, Н.и другие. Метаболиты, продуцируемые комменсальными бактериями, способствуют образованию периферических регуляторных Т-клеток. Природа 504 , 451–455 (2013).

    CAS Статья PubMed PubMed Central Google Scholar

  • 281

    Smith, P. M. et al. Микробные метаболиты, короткоцепочечные жирные кислоты, регулируют гомеостаз Treg-клеток толстой кишки. Наука 341 , 569–573 (2013).

    CAS Статья PubMed Google Scholar

  • 282

    Сингх Н.и другие. Активация Gpr109a, рецептора ниацина и бутирата метаболита комменсала, подавляет воспаление толстой кишки и канцерогенез. Иммунитет 40 , 128–139 (2014).

    CAS Статья PubMed PubMed Central Google Scholar

  • 283

    Cadwell, K. et al. Взаимодействие вируса с геном восприимчивости определяет фенотипы гена болезни Крона Atg16L1 в кишечнике. Cell 141 , 1135–1145 (2010).

    CAS Статья PubMed PubMed Central Google Scholar

  • 284

    Virgin, H. W. Виром в физиологии и болезнях млекопитающих. Cell 157 , 142–150 (2014).

    CAS Статья PubMed PubMed Central Google Scholar

  • 285

    Ahmed, S. et al. Бактериальное разнообразие слизистой оболочки в отношении образцов биопсии терминальной подвздошной кишки и толстой кишки человека. заявл. Environ. Microbiol. 73 , 7435–7442 (2007).

    CAS Статья PubMed PubMed Central Google Scholar

  • 286

    Hu, S. et al. Региональные различия микробиоты, связанной со слизистой оболочкой толстой кишки, определяют физиологическую экспрессию белков теплового шока хозяина. г. J. Physiol. Гастроинтест. Liver Physiol. 299 , G1266 – G1275 (2010). Это исследование описывает некоторые иммунологические последствия анатомических различий в составе кишечной микробиоты.

    CAS Статья PubMed PubMed Central Google Scholar

  • 287

    Белкайд Ю. и Хэнд Т. В. Роль микробиоты в иммунитете и воспалении. Cell 157 , 121–141 (2014).

    CAS Статья PubMed PubMed Central Google Scholar

  • 288

    Unthank, J. L. & Bohlen, H.G. Лимфатические пути и роль клапанов в продвижении лимфы из тонкой кишки. г. J. Physiol. 254 , G389 – G398 (1988).

    CAS PubMed Google Scholar

  • 289

    Миллер М. Дж., МакДоул Дж. Р. и Ньюберри Р. Д. Микроанатомия лимфатической системы кишечника. Ann. NY Acad. Sci. 1207 (Приложение 1), E21 – E28 (2010).

    Артикул PubMed Google Scholar

  • 290

    Кавасима, Ю., Сугимура, М., Хван, Ю.-К. & Кудо, Н. Лимфатическая система у мышей. Japanese J. Veterinary Res. 12 , 69–78 (1964).

    Google Scholar

  • Границы | Диетические привычки и иммунитет кишечника: от приема пищи до клеток CD4 + TH

    Введение

    В желудочно-кишечном тракте иммунная система постоянно находится под сильным давлением окружающей среды, постоянно сталкиваясь с широким спектром антигенов, полученных как из кишечной микробиоты, так и из пищи.Кишечные CD4 + Т-хелперные клетки (T H ) являются ключевыми медиаторами иммунитета слизистой оболочки, и в соответствии с их эффекторными функциями их можно разделить на разные популяции, а именно T H 1, T H 2 и T H 17, при этом клетки T H 17 относительно многочисленны в желудочно-кишечном тракте (1–4). Здесь разные виды бактерий определяют, приобретают ли кишечные CD4 + Т-клетки про- или противовоспалительные эффекторные фенотипы (5, 6), подчеркивая важную функцию кишечной микробиоты в поддержании гомеостаза слизистой оболочки.Провоспалительные реакции, вызываемые клетками T H , контролируются различными подмножествами CD4 + T-клеток с регуляторными способностями, а именно клетками T reg и T R 1, ключевыми игроками в стимулировании и поддержании толерантности слизистой оболочки к себе. — и пищевые антигены (7–9). Однако, когда толерантность слизистой оболочки не может ограничить провоспалительные иммунные реакции, это приводит к воспалению кишечника, которое может привести к развитию иммуноопосредованных воспалительных заболеваний (IMID), таких как воспалительные заболевания кишечника (IBD).ВЗК являются одними из ведущих заболеваний в западных странах (10, 11), и наблюдение, что клетки T H 17 и ассоциированные с T H 17 цитокины, такие как IL-17A, IL-17F и IL-22, обычно обогащены в воспаленной слизистой оболочке пациентов с ВЗК, предполагает, что клетки T H 17 вызывают воспаление кишечника (12, 13). Интересно, что CD4 + T-клетки, особенно T H 17 клетки, очень чувствительны к компонентам диеты западного типа (WTD) (14, 15), а WTD был связан с более высокой частотой ВЗК (16).Кроме того, было описано, что высокое потребление калорий, полученных из обработанного мяса, масла и жареных продуктов, всех компонентов WTD, мгновенно изменяет состав кишечной микробиоты, явление, называемое дисбиозом, в сторону более низкого соотношения Bacteroidetes и Firmicutes . (17–19). Дисбактериоз также часто встречается у пациентов, страдающих IMID, включая IBD (20–23). Однако, несмотря на эти сильные ассоциации, прямая причинно-следственная связь между WTD и развитием IBD еще не доказана.

    В этом обзоре мы обсуждаем, как изменения в диетических привычках в пользу WTD влияют на иммунитет кишечника, изменяя состав кишечной микробиоты и фенотип, а также функции эффекторных и регуляторных Т-клеток CD4 + . Кроме того, мы предполагаем, что WTD приводит как к более высокой восприимчивости к инфекциям, так и к более высокой частоте хронических аутоиммунных заболеваний, тем самым обостряя кишечное и внекишечное воспаление. Мы поддерживаем гипотезу о том, что добавление в рацион определенных продуктов бактериального или диетического происхождения может облегчить вызванное WTD воспаление, воздействуя на ось эффекторных / регуляторных Т-клеток и, в свою очередь, восстанавливая гомеостаз кишечника (рис. 1).Результаты, представленные в этом обзоре, в основном основаны на экспериментах на мышах и, по возможности, проверены на людях.

    Рисунок 1 . Влияние диетических привычек на местный и системный гомеостаз и иммунитет. Графический аннотация, резюмирующая основные выводы, которые будут обсуждаться в этом обзоре. Сообщается, что диеты западного типа, богатые жирами, холестерином, сахаром и солью, вызывают воспаление кишечника и вне кишечника, вызывая микробный дисбактериоз и изменение баланса про- и противовоспалительных Т-клеток в кишечнике, в конечном итоге ослабляя кишечник. иммунитет и влияющий на гомеостаз кишечника.Напротив, диеты, обогащенные клетчаткой, индолами и витаминами, оказывают благотворное влияние на гомеостаз кишечника за счет увеличения разнообразия микробов и создания регулирующей среды.

    Кишечная иммунная система и микробиота

    Кишечная иммунная система способствует повышению иммунитета слизистых оболочек и поддерживает толерантность к диетическим и микробным антигенам как за счет своих врожденных, так и адаптивных компонентов, расположенных в эпителии кишечника и собственной пластинке кишечника.

    Помимо М-клеток и интраэпителиальных лимфоцитов (IEL), бокаловидные клетки, клетки Панета и врожденные лимфоидные клетки 3 типа (ILC3) составляют врожденное звено кишечной иммунной системы.С другой стороны, секретирующие антитела плазматические клетки, CD4 + и CD8 + Т-клетки представляют собой адаптивную иммунную систему кишечника. Муцины, секретируемые бокаловидными клетками, образуют единый слой слизи тонкой кишки и двухслойную слизь толстой кишки, причем внутренний слой непроницаем для бактерий (24). ILC3 эффективно способствуют гомеостазу кишечника за счет секреции IL-17 и IL-22 (25, 26), которые инструктируют клетки Панета секретировать антимикробные пептиды (AMP) в просвет кишечника.Хотя врожденные компоненты кишечной иммунной системы имеют основополагающее значение для обеспечения первой линии защиты от вторженных микробов, в этом обзоре основное внимание уделяется клеткам CD4 + T H , учитывая их уникальную роль в организации адаптивных иммунных ответов и защите от инфекций.

    Среди различных субнаборов клеток CD4 T H , клетки T H 17 относительно многочисленны в желудочно-кишечном тракте (27). Они характеризуются экспрессией основного фактора транскрипции RORγt, хемокинового рецептора CCR6 и арилуглеводородного рецептора фактора транскрипции (AhR) (28, 29).Клетки T H 17 секретируют наибольшее количество IL-17 и IL-22, способствуя защите от грибковых и бактериальных инфекций, в конечном итоге поддерживая иммунитет слизистых оболочек (1). Однако наблюдение, что высокие уровни IL-17 и IL-22 обнаруживаются в воспаленной слизистой оболочке пациентов, страдающих ВЗК, подчеркивает их двойственную роль в ограничении или стимулировании воспаления кишечника (12, 13). Полная блокада IL-17A не способствовала уменьшению воспаления кишечника при болезни Крона, что можно объяснить предотвращением полезных действий IL-17A, таких как стимулирование выработки AMP, что в конечном итоге защищает хозяина от вторжения микробов (30).В соответствии с этим было также показано, что T-клетки TCRγδ + , секретирующие IL17, опосредуют проницаемость кишечника и оказывают защитную функцию на целостность эпителиального барьера (31). В то же время было показано, что Т-клетки с дефицитом ИЛ-17А вызывают более агрессивный исход заболевания на мышиной модели трансферного колита (32). Взятые вместе, эти результаты предполагают, что клеточный источник продукции IL-17A может определять полезную или вредную роль самого цитокина. Следовательно, клеточно-специфическое нацеливание на IL-17A может открыть новые терапевтические подходы.Кроме того, было описано, что клетки T H 17 представляют собой высокопластичную клеточную популяцию, способную приобретать свойства, типичные для других подмножеств Т-клеток CD4 + (33). Благодаря своей высокой пластичности клетки T H 17 могут быть полезными или вредными для хозяина в соответствии с профилем цитокинов, который они проявляют в ответ на воспалительные стимулы. В то время как IL-12 и IL-23 управляют преобразованием клеток T H 17 в провоспалительные клетки T H 1, вызывая приобретение T-bet и CXCR3 и секрецию IFN-γ (33, 34), воздействие к лигандам TGF-β и AhR опосредуют получение секреции IL-10 от T H 17, тем самым превращая их в противовоспалительные клетки T R 1 exTh27 (35, 36).Характеризуется отсутствием Foxp3 и экспрессией коингибиторных рецепторов CD49b и LAG-3 (37), как bona fide , так и T H 17-производные клетки T R 1 (т.е. T R 1 exTh27 ) ограничивают распространение провоспалительных клеток T H 17 IL-10-зависимым образом (38). Кроме того, патогенность клеток T H 17 также контролируется клетками Foxp3 + T reg (38), которые, как и клетки T R 1 и T H 17, относительно многочисленны в тонкий кишечник, в котором всасывается большая часть пищевых продуктов (9).Таким образом, про- и противовоспалительные Т-клетки CD4 + сосуществуют в желудочно-кишечном тракте, находясь в высокодинамичной микросреде.

    Дополнительный уровень сложности к этому жесткому балансу про- и противовоспалительных клеток добавляет микробиота, состав и численность которой варьируются вдоль ЖКТ (39–41). Все чаще признается, что кишечная микробиота выполняет неизбыточные функции в поддержании гомеостаза хозяина, начиная от синтеза питательных веществ и заканчивая защитой от вторжения патогенов и модуляцией иммунных ответов (42–44).Действительно, исследования на мышах, свободных от микробов (GF), подчеркнули более высокую восприимчивость к вирусным или бактериальным инфекциям у мышей, лишенных кишечной микробиоты, по сравнению с мышами, содержащимися в условиях, свободных от конкретных патогенов (SPF) (45, 46). Вероятно, это связано с тем, что виды бактерий определяют фенотип Т-лимфоцитов CD4 + . Например, Bacteroides fragilis способствует дифференцировке наивных CD4 + Т-клеток в направлении продуцирующих IFN-γ клеток T H 1 (6), тогда как сегментированных нитчатых бактерий (SFB) стимулирует дифференцировку в направлении секреции IL-17. Т Н 17 ячеек (5).Следует отметить, что присутствие SFB в кишечной микробиоте предотвращает рост патогенных Citrobacter rodentium , вероятно, из-за индукции T H 17, уменьшая воспаление толстой кишки (5). Эти данные еще раз подчеркивают дуалистическую природу клеток T H 17 в предотвращении или обострении воспаления кишечника.

    Состав кишечной микробиоты и, в свою очередь, кишечных CD4 + Т-лимфоцитов, таким образом, являются ключевыми игроками в обеспечении гомеостаза слизистой оболочки.С одной стороны, виды бактерий способны формировать иммунные функции кишечника, модулируя ответы Т-клеток CD4 + . С другой стороны, в то время как клетки T H 17 опосредуют иммунитет к вторгающимся микробам, клетки Foxp3 + T reg и T R 1 поддерживают толерантность к собственным и диетическим антигенам, предотвращая также неконтролируемый T H 17 иммунных ответов, опосредованных клетками. Неспособность подавить неконтролируемый CD4 + T H клеточно-опосредованный иммунный ответ может привести к ВЗК, что наблюдается у мышей, лишенных критических генов, связанных с иммуносупрессией, таких как IL-10, у которых развивается спонтанный колит (47).В соответствии с этим, ВЗК были определены по аберрантным клеточным ответам CD4 + T H против комменсальной микробиоты у генетически восприимчивых хозяев (48). Каким образом развиваются комменсал-специфические клеточные ответы CD4 + T H , было рассмотрено в другом месте (49).

    Диетические привычки в западных странах

    Диетические привычки оказывают огромное влияние на образ жизни людей. Высокое содержание липидов в WTD, часто происходящих из насыщенных жирных кислот и холестерина, помимо избыточного потребления сахара, связано с более высокой заболеваемостью колоректальным раком и IMID (50–52).Кроме того, повышенное потребление соли и потребление средних (MCFA) и длинноцепочечных жирных кислот (LCFA), таких как лауриновая и пальмитиновая кислоты, вызывают или усугубляют воспаление, воздействуя на кишечную микробиоту, а также на врожденные и адаптивные компоненты кишечная иммунная система (53–55).

    Диетические привычки, благоприятствующие WTD, также соответствуют пониженному усвоению витаминов и потреблению овощей и фруктов, богатых клетчаткой. Пищевые волокна состоят из некрахмальных полисахаридов, целлюлозы, лигнина и других олиго- или полисахаридов растительного происхождения, которые не усваиваются и не всасываются в тонком кишечнике (56).Считается, что диета, богатая клетчаткой, полезна для хозяина, а режимы питания, благоприятствующие потреблению клетчатки, были связаны со снижением риска диабета 2 типа (T2D), сердечно-сосудистых заболеваний и воспаления кишечника (57–59). Это говорит о том, что клетчатка потенциально может модулировать связанные и не связанные с кишечником иммунные реакции. Однако то, как клетчатка уменьшает воспаление, остается малоизученным. Один из возможных механизмов может заключаться в его ферментации бактериями в толстой кишке, что приводит к образованию короткоцепочечных жирных кислот (SCFA) (60, 61).Действительно, ацетат, бутират и пропионат, все SCFAs, опосредуют положительные эффекты на хозяина за счет задействования рецепторов, связанных с G-белком (GPR), экспрессируемых различными клетками, включая CD4 + T-клетки кишечника (62). Кроме того, недавние данные свидетельствуют о том, что положительное влияние потребления клетчатки на хозяина может заключаться в изменениях, которые оно вызывает в составе самой кишечной микробиоты (63).

    Короче говоря, пищевые привычки сильно влияют на здоровье человека, модулируя функцию CD4 + Т-клеток и состав кишечной микробиоты.

    WTD вызывает воспаление слизистых оболочек, изменяя иммунитет

    Липиды, холестерин и соль

    В этой части обзора мы описываем влияние высокого потребления липидов, холестерина и соли на иммунную систему кишечника, анализируя сложное взаимодействие между адаптивными иммунными клетками и кишечной микробиотой. Затем мы резюмируем недавние результаты о том, как режимы питания, поддерживающие WTD, повышают восприимчивость к хроническим аутоиммунным заболеваниям и инфекциям, вызываемым комменсальными бактериями (таблица 1).В конечном итоге мы предлагаем, как можно модулировать кишечное и внекишечное воспаление, вызванное WTD, путем добавления определенных биопродуктов микробного или диетического происхождения, которые, в свою очередь, действуют на Т-клетки CD4 + .

    Таблица 1 . Таблица, показывающая, как различные компоненты WTD управляют клеточными и функциональными фенотипами, связанными с кишечным и внекишечным воспалением.

    Помимо индукции системного хронического воспаления низкой степени, типичного для ожирения (76, 77), WTD способствует локальному воспалению кишечника посредством различных механизмов, часто связанных с изменением состава кишечной микробиоты (т.э., дисбактериоз). На рисунке 2 представлена ​​графическая сводка.

    Рисунок 2 . Липиды, холестерин и соль формируют фенотип Т-лимфоцитов CD4 + кишечника микробиотозависимым или независимым образом. (A) Высокое потребление липидов вызывает дисбактериоз, сдвигая состав кишечной микробиоты в сторону более высокого соотношения: Proteobacteria и Firmicutes к Bacteroidetes . Это может привести к более высокой восприимчивости к инфекциям патобионтов, например.грамм. из инвазивной E. coli или Bilophila wadsworthia (BW). Слои слизи тонкой и толстой кишки истончаются, что приводит к более высокой проницаемости кишечника, что, в свою очередь, способствует вторжению грамотрицательных бактерий и обостряет воспаление кишечника. Кроме того, диета, богатая насыщенными жирными кислотами, увеличивает уровни провоспалительных цитокинов, таких как IL-1β, IL-6, TNF-α, в желудочно-кишечном тракте (GI), способствуя воспалительному состоянию. (B) Диеты, богатые холестерином, изменяют состав желчных кислот и повышают уровни IL-1β в тонком кишечнике, создавая воспалительную среду, которая может привести к более высокой восприимчивости к инфекциям с BW, патогеном, который, как известно, требует желчи. кислоты, чтобы перерасти.Метаболиты холестерина также могут модулировать воспаление кишечника, ингибируя или стимулируя развитие клеток T H 17 посредством взаимодействия с LXR или RORγt соответственно. (C) При воспалении кишечника, вызванном WTD, соль может прямо или косвенно изменять фенотип клеток CD4 + T H 17 и T reg , ухудшая гомеостаз слизистой оболочки. Посредством запуска сывороточной глюкокортикоид киназы-1 (SGK1) соль стимулирует экспрессию IL-23R на клетках T H 17, вызывая их патогенность, и способствует секреции IFN-γ клетками T reg , ослабляя их подавляющую способность. .Кроме того, высокое потребление соли может увеличить частоту патогенных клеток T H 17, снижая количество Lactobacillus spp. в желудочно-кишечном тракте.

    Высокое потребление жиров увеличивает уровни IL-1β, IL-6, TNF-α и NF-κB в толстой кишке (64, 65), что приводит к более высокой концентрации липокалина 2 (Lcn2) в кале, биомаркера. воспаления кишечника (78). Истончение слизистых слоев тонкой и толстой кишки (67, 68) и более высокая проницаемость кишечника (66) приводят к увеличению присутствия вторгающихся грамотрицательных бактерий и повышению уровня ЛПС в плазме (79, 80), усугубляя местное и системное воспаление. .Эти результаты показывают, что высокое содержание липидов в WTD влияет на гомеостаз слизистой оболочки, вызывая истончение защитных слоев кишечной слизи и, таким образом, увеличивая проницаемость кишечника и уровни провоспалительных цитокинов.

    Точно так же высокое потребление холестерина увеличивает уровни IL-1β в тонком кишечнике мышей и частоту клеток CD11b + и CD11c + (74). Аналогичным образом, мыши с дефицитом Х-рецептора печени (LXR) (LXRαβ — / — ), у которых отсутствует рецептор оксистеринов (т.е.е. метаболиты холестерина), получавших в течение 8 или 16 недель WTD, показали более высокие титры антинуклеарных антител (ANA), увеличенное количество B-клеток и усиленное праймирование клеток T H , что привело к развитию волчаночного аутоиммунного заболевания (75). Хотя эти результаты предполагают, что метаболизм холестерина посредством LXR имеет решающее значение для предотвращения аутоиммунитета, влияние избыточного потребления пищевого холестерина на клетки T H все еще остается неясным. Действительно, было показано, что оксистерины как благоприятствуют, так и ингибируют дифференцировку клеток T H 17 посредством прямого связывания с RORγt (81) или вовлечения LXR (82) соответственно, приписывая холестерину зависимую от контекста полезную или вредную роль.Высокий уровень холестерина может также увеличивать выработку желчных кислот (ЖК), а высокая концентрация ЖК в толстой кишке, наряду с мальабсорбцией БА, была предложена в качестве возможной причины диареи (83), состояния, которое обычно присутствует у пациентов, страдающих от ВЗК. Однако этиология диареи у пациентов с ВЗК все еще обсуждается, и ее можно приписать сумме факторов, включая воспаление кишечника и нарушение целостности барьера, а не одному-единственному фактору.

    Было показано, что помимо прямого воздействия на CD4 + Т-клетки, диета, богатая липидами и холестерином, резко изменяет состав кишечной микробиоты.Следует отметить, что фенотип и эффекторные функции кишечных CD4 + Т-клеток строго связаны с различными видами бактерий микробиоты, и кишечная микробиота быстро реагирует на изменения в режимах питания. Действительно, длительное кормление мышей с WTD сдвигает состав кишечной микробиоты в сторону более высокого соотношения: Proteobacteria и Firmicutes видов по сравнению с Bacteroidetes (19, 70), что приводит к более высокой восприимчивости к инфекциям патобионтов инвазивным E .coli (71, 72). Точно так же диеты, богатые насыщенными жирами, полученными из молока, способствуют росту патобионта Bilophila wadsworthia (BW) в толстой кишке мышей IL-10 — / — , увеличивая частоту спонтанного колита (69) и мышей SPF. колонизированные BW, демонстрируют более высокую экспрессию IL-6 и сывороточного амилоида A (SAA), проявляя системное воспаление (84). Следует отметить, что для культивирования BW требуется желчь в своей среде (85), а диеты, богатые насыщенными жирами, полученными из молока, увеличивают количество таурин-конъюгированных желчных кислот (TCA) (69), что указывает на пока еще не определенную перекрестную разговор между составом желчных кислот и кишечной микробиотой.

    Эти данные не только показывают, что кишечная микробиота очень восприимчива к нарушениям режима питания, но также выявляют прямую связь между WTD, дисбактериозом и повышенной восприимчивостью к инфекциям и колиту. Необходимы дальнейшие исследования, чтобы проанализировать, как конкретные виды бактерий действуют на различные популяции CD4 + Т-клеток.

    Интересно, что дисбактериоз является общей чертой пациентов, страдающих ВЗК, что отражается более низкой сложностью видов микробов (86), а также повышенными частотами клеток T H 17 и количествами IL-17 и IL-22 по сравнению с здоровым людям (12, 13).

    Однако до сих пор неясно, изменяет ли WTD сначала состав кишечной микробиоты, которая, в свою очередь, индуцирует провоспалительные клетки T H 17 и способствует воспалению кишечника, или наоборот. Более того, точные компоненты WTD, способные воздействовать на микробиоту и / или клетки T H 17, еще предстоит полностью идентифицировать.

    В последние годы большое внимание уделяется соли . Ву и др. . показали, что сывороточная глюкокортикоидкиназа-1 (SGK1) управляет экспрессией IL-23R в клетках T H 17 посредством инактивации Foxo1 (15), и известно, что экспрессия IL-23R на клетках T H 17 определяет их патогенность (87, 88).Интересно, что SGK1, как было показано, регулирует чувствительность к соли разными типами клеток, включая клетки эпителиальной толстой кишки (89, 90). В своей работе Wu et al . показали, что у мышей, получавших пищу с высоким содержанием соли (HSD) в течение 3 недель, наблюдались более высокие частоты клеток собственной пластинки (LP) T H 17 по сравнению с мышами, получавшими нормальную пищу. Кроме того, мыши, получавшие HSD, были более восприимчивы к экспериментальному аутоиммунному энцефаломиелиту (EAE), показывая заметную инфильтрацию T H 17 в их центральной нервной системе (ЦНС) (15).Подобный фенотип был описан у мышей, получавших диету, богатую лауриновой кислотой (53). Вдоль той же линии у мышей, получавших HSD, наблюдалось усиление кишечного воспаления у мышей IL-10 — / — (55) и повышенная тяжесть индуцированного декстрансульфатом натрия (DSS) и 2,4-динитробензолсульфоновой кислоты (DNBS). колит (54). Эти исследования не только показывают, что пищевые привычки, благоприятствующие WTD, действуют локально, вызывая воспаление кишечника, но также предполагают связь между режимами питания и внекишечным воспалением.Кроме того, недавние данные пилотного исследования на людях показали, что 14-дневная солевая стимуляция увеличивает количество циркулирующих IL-17A- и TNF-α-секретирующих клеток T H 17. Это было связано с повышением артериального давления, которое является фактором риска атеросклероза (14). Также было описано, что высокое потребление соли индуцирует секрецию IFN-γ клетками T reg человека, ингибируя их подавляющую функцию как in vitro , так и in vivo в зависимости от SGK1 (73).Взятые вместе, эти исследования показывают, что соль напрямую изменяет фенотип и эффекторные функции Т-клеток CD4 + независимо от микробиоты.

    Однако также сообщалось, что соль оказывает сильное влияние на состав кишечной микробиоты и только косвенно на эффекторные функции кишечных клеток T H (91).

    Две исследовательские группы независимо друг от друга сообщили, что высокое потребление соли снижает уровень Lactobacillus spp , что в конечном итоге способствует воспалению (14, 54).Вызванное HSD истощение Lactobacillus murinus ( L. murinus ) увеличивало частоту LP T H 17 клеток в тонком кишечнике и толстой кишке, а добавка L. murinus улучшала EAE за счет снижения количества T H 17 клетки спинного мозга мышей, получавших HSD (14). Важно отметить, что колонизация мышей GF либо одним SFB, либо SFB и L. murinus приводила к высокой или низкой частоте клеток LP T H 17, что позволяет предположить, что L.murinus модулирует клетки T H 17. Эти данные свидетельствуют о том, что пищевые привычки влияют на фенотип Т-клеток и их эффекторные функции как микробиотозависимым, так и независимым образом, определяя, проявляют ли они защитную или патогенную роль в кишечном иммунитете.

    Кроме того, сообщалось, что HSD снижает уровень индол-3-молочной кислоты (ILA) и бутирата в просвете просвета (14, 54). Бутират способствует экспрессии Foxp3, стабилизируя фенотип LP T reg , поэтому его уменьшение, вызванное HSD, может изменять гомеостаз кишечника (92).

    В совокупности повышение потребления липидов, холестерина и солей приводит к изменениям состава кишечной микробиоты, что, в свою очередь, влияет на фенотип и эффекторную функцию кишечных CD4 + Т-клеток. В конечном итоге это может привести к более высокой восприимчивости как к кишечным, так и к внекишечным инфекциям и к повышенному риску развития хронических аутоиммунных заболеваний.

    Клетчатка, индолы и витамины

    В этой части обзора мы описываем влияние низкого содержания клетчатки, индолов и витаминов, связанного с WTD, на адаптивные компоненты кишечной иммунной системы.Затем мы предлагаем, как дополнение рациона определенными биопродуктами бактериального и диетического происхождения может восстановить нарушенный гомеостаз кишечника. Эти выводы кратко представлены в Таблице 2.

    Таблица 2 . Таблица, показывающая эффекты, которые диетические добавки с определенными биопродуктами могут оказывать на фенотип Т-лимфоцитов CD4 + , а также на воспаление кишечника и вне кишечника.

    Было показано, что люди с низким видовым разнообразием бактерий демонстрируют более высокий индекс массы тела (ИМТ), уровень триглицеридов сыворотки, гемоглобина A1c (HbA1c) и С-реактивного белка по сравнению с лицами с более высоким разнообразием, что указывает на ключевую роль кишечной микробиоты. в поддержании метаболического гомеостаза (105, 106).Обеспечение клетчатки микробным сообществом поддерживает его видовое разнообразие (107), а диета с низким содержанием пищевых волокон связана с воспалением кишечника (108, 109). Благоприятные эффекты пищевых волокон на гомеостаз слизистой оболочки графически представлены на рисунке 3. Лишение клетчатки вызывает приближение кишечных бактерий к эпителию за счет истончения слоев слизи (110), предрасполагая к патогенным инфекциям, вызываемым Citrobacter rodentium (63). Точно так же у мышей, получавших только клетчатку или инулин, было обнаружено обогащение SCFA-продуцирующими видами бактерий, что ограничивало рост Clostridium difficile , что подчеркивает терапевтический потенциал пищевых добавок с клетчаткой (111).Кроме того, Kim et al . показали, что мыши, у которых отсутствует связанный с G-белком рецептор GPR43, один из основных рецепторов SCFAs в кишечнике, проявляют более высокую восприимчивость к патогенным инфекциям, DSS-индуцированному колиту и азоксиметану (AOM) / DSS-индуцированному канцерогенезу, что связано с повышенной частотой ЛП толстой кишки T H 17 и снижение частоты T reg клеток (112, 113). Точно так же в модели трансферного колита добавка SCFA уменьшала воспаление кишечника, увеличивая популяцию клеток T reg в зависимости от GPR43 (93).Среди SCFA было показано, что бутират увеличивает образование экстра-тимических клеток T reg за счет стимулирования ацетилирования промотора Foxp3 и консервативной некодирующей последовательности 1 (CNS1), энхансерного элемента в локусе Foxp3 (95). Добавка бутирата также защищала мышей, получавших HFD, от развития спонтанных опухолей тонкого кишечника в модели K-ras G12Din (94). Точно так же введение ацетата увеличивало частоту клеток, продуцирующих IL-17, во время активного иммунного ответа на Citrobacter rodentium , что приводило к увеличению бактериального клиренса (96).

    Рисунок 3 . Клетчатка, индолы и витамины действуют синергетически, способствуя гомеостазу кишечника. (A) Рацион, богатый клетчаткой, способствует разнообразию видов бактерий и бактерий, продуцирующих короткоцепочечные жирные кислоты (SCFA), которые, в свою очередь, ограничивают рост патогенов, например Clostridium difficile и способствует целостности барьера. SCFAs также поддерживают гомеостаз кишечника при задействовании GPR43, экспрессируемого на эпителиальных клетках кишечника. Кроме того, SCFA могут напрямую взаимодействовать с кишечными CD4 + Т-клетками, сдвигая баланс клеток T reg / T H 17 в сторону клеток T reg , тем самым вызывая регуляторное микросредство. (B) В просвете желудочно-кишечного тракта превращение индолов в биологически активные лиганды AhR способствует поддержанию гомеостаза кишечника, действуя на клетки врожденного и адаптивного иммунитета. С одной стороны, участие AhR его лигандами индуцирует секрецию IL-22 из ILC3, что, в свою очередь, способствует продукции антимикробных пептидов (AMP) из клеток Панета. С другой стороны, запуск оси AhR на клетках T H 17 опосредует их превращение в клетки T R 1, секретирующие IL-10, которые, в свою очередь, способны прекращать иммунные ответы. (C) Биологически активная форма all- trans ретиноевой кислоты (ATRA) витамина A индуцирует экспрессию рецепторов CCR9 и интегрина α4β7 кишечника на клетках T reg , способствуя созданию регуляторного микроокружения внутри GI. тракта, который дополнительно увеличивается за счет уменьшения кишечных клеток T H 17. Точно так же вовлечение VDR активными метаболитами витамина D ослабляет секрецию IL-17 клетками T H 17.

    Взятые вместе, эти результаты показывают не только решающую роль SCFAs как медиаторов кишечного иммунитета и гомеостаза слизистых оболочек за счет их прямого воздействия на CD4 + Т-клетки, но они косвенно указывают также на важность присутствия SCFA-продуцирующих бактерий. виды в кишечной микробиоте.

    Помимо низкого содержания клетчатки, WTD также беден фруктами и овощами, которые, как было показано, оказывают положительное влияние на здоровье человека (114). Зеленые овощи, особенно принадлежащие к роду Brassica , содержат индолы, которые превращаются в биологически активные лиганды AhR (115). AhR экспрессируется различными типами кишечных клеток, включая IEL, ILC3 и клетки T H 17 (116, 117). Недостаток AhR снижает экспрессию AMP, увеличивает проницаемость кишечника при колите, вызванном DSS, и усугубляет активацию иммунной системы (115).Кроме того, мыши AhR — / — демонстрируют снижение продуцирующих IL-22 ILC3, что приводит к более высокой пригодности SFB, который, в свою очередь, способствует развитию кишечных клеток T H 17 (117, 118). В то же время наблюдение, что AhR поддерживает дифференцировку клеток T H 17 посредством взаимодействия с STAT1 (97), предполагает, что развитие клеток LP T H 17 может быть опосредовано посредством AhR-зависимого механизма. Интересно, что участие AhR через 6-формилиндоло [3,2-b] карбазол (FICZ) в in vitro дифференцированных клетках T H 17 индуцирует приобретение IL-10, способствуя их превращению в клетки T R 1.Это указывает на то, что лиганды AhR могут способствовать разрешению иммунных ответов (35). Поэтому интересно предположить, что диета, богатая зелеными овощами, может ограничивать воспаление кишечника у пациентов, страдающих ВЗК, посредством контролируемого AhR превращения провоспалительных клеток T H 17 в регуляторные клетки T R 1. Однако это еще предстоит доказать.

    Дифференциация и стабильность фенотипа клеток T H 17 также могут модулироваться витаминами, особенно A и D, содержание которых снижено при WTD.В тонком кишечнике пищевой витамин A превращается CD103 + DC в биологически активную форму all- trans retinoic acid (ATRA) (119, 120). Подробная роль ATRA в формировании кишечного иммунитета была рассмотрена в другом месте (121). Было показано, что введение ATRA уменьшает воспаление кишечника у мышей, страдающих DSS- или TNBS-индуцированным колитом (98, 99), вероятно, за счет сдвига баланса T reg / T H 17 в пользу клеток T reg (100, 101).Добавление ATRA к TGF-β во время дифференцировки клеток T reg также увеличивает их способность мигрировать в LP (7) и их супрессивные способности in vivo на мышиной модели трансфер-колита (100). Следует отметить, что мыши, получавшие диету с дефицитом витамина A (VAD), показали существенное снижение количества LP CD4 + T-клеток в тонком кишечнике из-за решающей роли витамина A в опосредовании индукции CCR9 и α4β7. интегрин, ключевые молекулы самонаведения кишечника (102).По той же линии, Tejon et al . показали, что во время воспаления кишечника дифференцированных in vitro клеток T reg были способны эффективно превращаться в клетки T H 17 при переносе мышам, получавшим VAD, что указывает на противовоспалительный эффект ATRA (122).

    С одной стороны, создание более регулирующей среды в воспаленной слизистой оболочке пациентов, страдающих ВЗК, с помощью добавок витамина А может показаться заманчивым. С другой стороны, однако, применение его эффектов в клиниках оказалось проблематичным, и на данный момент нет доказательств, свидетельствующих о благотворном влиянии добавок витамина А на здоровье пациентов с ВЗК.

    Подобно витамину A, содержание витамина D в WTD низкое, а полиморфизм гена рецептора витамина D (VDR) связан с более высокой частотой ВЗК (123). Следует отметить, что клетки T H 17 могут быть чувствительны к уровням витамина D, учитывая их экспрессию VDR. В соответствии с этим было показано, что высокое потребление витамина D снижает секрецию IL-17A и IL-17F клетками T H 17, в конечном итоге улучшая клинические проявления EAE (103). Аналогичным образом, недавно сообщалось, что клиническая активность пациентов с активным язвенным колитом (ЯК) улучшилась после еженедельного приема холекальциферола (104).Однако изменений в кишечном и системном воспалении не наблюдалось, а другие клинические испытания, включающие добавление витамина D пациентам, страдающим ВЗК, не показали существенного улучшения клинических параметров (124).

    Взятые вместе, хотя эти результаты ставят под сомнение возможную терапевтическую роль только витаминных добавок в облегчении воспаления кишечника, они подчеркивают потенциал пищевых компонентов в модуляции фенотипа Т-лимфоцитов CD4 + .Среди них SCFAs и лиганды AhR могут способствовать гомеостазу кишечника и способствовать иммунитету слизистых оболочек. Однако необходимы трансляционные исследования, которые в конечном итоге прольют свет на их эффективность в клиниках.

    Выводы и перспективы

    Начинают появляться данные о влиянии биологически активных компонентов диеты на иммунитет слизистых оболочек и гомеостаз. Западные диетические привычки, благоприятствующие высокому потреблению липидов, холестерина и соли, стимулируют местное кишечное и внекишечное воспаление, формирующее фенотип и эффекторные функции CD4 + Т-клеток зависимым или независимым от микробиоты образом.Это может привести к изменению кишечного иммунитета, что в конечном итоге приведет к более высокой восприимчивости к инфекциям, вызываемым кишечными патогенами, и увеличению риска хронических воспалительных аутоиммунных заболеваний. Однако вызванное WTD воспалительное состояние может быть потенциально обращено вспять путем дополнения рациона пищей, богатой клетчаткой и индолами, которые представляют собой многообещающий терапевтический инструмент для модуляции гомеостаза кишечника путем воздействия на ось клеток T H 17 / T reg . и восстановление видов бактерий, продуцирующих SCFA.

    Авторские взносы

    FS и NS написали рукопись и подготовили таблицы и рисунки. Е.В. и Ш. редактировали рукопись. Н.Г. руководила и редактировала рукопись.

    Финансирование

    Эта работа была поддержана ERC (StG 715271 — NG и StG 337215 — SH).

    Заявление о конфликте интересов

    Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

    Список литературы

    2. Лакхирам Р.В., Чжоу Р., Верма А.Д., Ся Б. CD4 (+) Т-клетки: дифференциация и функции. Clin Dev Immunol. (2012) 2012:

    5. DOI: 10.1155 / 2012/

    5

    CrossRef Полный текст | Google Scholar

    3. Мосманн Т.Р., Коффман Р.Л. Клетки Th2 и Th3: разные паттерны секреции лимфокинов приводят к различным функциональным свойствам. Ann Rev Immunol. (1989) 7: 145–73. DOI: 10.1146 / annurev.iy.07.040189.001045

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    5. Иванов И.И., Атараши К., Манель Н., Броди Э.Л., Шима Т., Караоз У и др. Индукция кишечных клеток Th27 сегментированными нитчатыми бактериями. Cell (2009) 139: 485–98. DOI: 10.1016 / j.cell.2009.09.033

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    6. Мазманян С.К., Лю С.Х., Цианабос А.О., Каспер Д.Л. Иммуномодулирующая молекула симбиотических бактерий направляет созревание иммунной системы хозяина. Cell (2005) 122: 107–18. DOI: 10.1016 / j.cell.2005.05.007

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    7. Кассани Б., Вильябланка Э. Дж., Кинтана Ф. Дж., Лав П. Е., Лейси-Халберт А., Бланер В. С. и др. Кишечные Т-клетки, экспрессирующие интегрин альфа4бета7 и CCR9, необходимы для индукции оральной иммунной толерантности у мышей. Гастроэнтерология (2011) 141: 2109–18. DOI: 10.1053 / j.gastro.2011.09.015

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    8.Coombes JL, Siddiqui KR, Arancibia-Carcamo CV, Hall J, Sun CM, Belkaid Y, et al. Функционально специализированная популяция CD103 + DC слизистой оболочки индуцирует Foxp3 + регуляторные Т-клетки посредством TGF-бета и механизма, зависимого от ретиноевой кислоты. J Exp Med. (2007) 204: 1757–64. DOI: 10.1084 / jem.20070590

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    9. Ким К.С., Хонг С.В., Хан Д., Йи Дж., Юнг Дж., Ян Б.Г. и др. Пищевые антигены ограничивают иммунитет слизистых оболочек, индуцируя регуляторные Т-клетки в тонком кишечнике. Science (2016) 351: 858–63. DOI: 10.1126 / science.aac5560

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    10. Эль-Габалави Х., Гюнтер Л.С., Бернштейн С.Н. Эпидемиология иммуноопосредованных воспалительных заболеваний: заболеваемость, распространенность, естественное течение и сопутствующие заболевания. J Rheumatol Suppl. (2010) 85: 2–10. DOI: 10.3899 / jrheum.0

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    11. Teng MW, Bowman EP, McElwee JJ, Smyth MJ, Casanova JL, Cooper AM и др.Цитокины IL-12 и IL-23: от открытия до таргетной терапии иммуноопосредованных воспалительных заболеваний. Nat Med. (2015) 21: 719–29. DOI: 10,1038 / нм. 3895

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    12. Фуджино С., Андох А., Бамба С., Огава А., Хата К., Араки Ю. и др. Повышенная экспрессия интерлейкина 17 при воспалительном заболевании кишечника. Gut (2003) 52: 65–70. DOI: 10.1136 / gut.52.1.65

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    13.Зайдерер Дж., Эльбен I, Дигельманн Дж., Глас Дж., Сталльхофер Дж., Тиллак С. и др. Роль нового цитокина IL-17F Th27 в воспалительном заболевании кишечника (ВЗК): усиление экспрессии IL-17F в толстой кишке при активной болезни Крона и анализ полиморфизма p.His161Arg IL17F при ВЗК. Воспаление кишечника. (2008) 14: 437–45. DOI: 10.1002 / ibd.20339

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    14. Wilck N, Matus MG, Kearney SM, Olesen SW, Forslund K, Bartolomaeus H, et al.Комменсал кишечника, чувствительный к соли, модулирует ось Th27 и болезнь. Nature (2017) 551: 585–9. DOI: 10.1038 / природа24628

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    15. Ву К., Йосеф Н., Талхамер Т., Чжу К., Сяо С., Киши Ю. и др. Индукция патогенных клеток Th27 индуцибельной солевой киназой SGK1. Nature (2013) 496: 513–7. DOI: 10.1038 / природа11984

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    16. Чепмен-Кидделл, Калифорния, Дэвис П.С., Гиллен Л., Рэдфорд-Смит, Г.Л.Роль диеты в развитии воспалительного заболевания кишечника. Воспаление кишечника. (2010) 16: 137–51. DOI: 10.1002 / ibd.20968

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    17. Cani PD, Bibiloni R, Knauf C, Waget A, Neyrinck AM, Delzenne NM, et al. Изменения микробиоты кишечника контролируют воспаление, вызванное метаболической эндотоксемией, при ожирении и диабете, вызванном диетой с высоким содержанием жиров. Диабет (2008) 57: 1470–81. DOI: 10.2337 / db07-1403

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    18.Turnbaugh PJ, Ley RE, Mahowald MA, Magrini V, Mardis ER, Gordon JI. Микробиом кишечника, связанный с ожирением, с повышенной способностью собирать энергию. Nature (2006) 444: 1027–31. DOI: 10.1038 / nature05414

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    19. Чжан Ц., Чжан М., Панг Х, Чжао Ю., Ван Л., Чжао Л. Структурная устойчивость кишечной микробиоты у взрослых мышей при нарушениях питания с высоким содержанием жиров. ISME J. (2012) 6: 1848–57. DOI: 10.1038 / ismej.2012,27

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    21. Франк Д.Н., Робертсон К.Э., Хамм С.М., Кпаде З., Чжан Т., Чен Х. и др. Фенотип и генотип заболевания связаны со сдвигами в кишечной микробиоте при воспалительных заболеваниях кишечника. Воспаление кишечника. (2011) 17: 179–84. DOI: 10.1002 / ibd.21339

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    22. Маэда Ю., Куракава Т., Умемото Е., Мотоока Д., Ито Ю., Гото К. и др.Дисбиоз способствует развитию артрита за счет активации аутореактивных Т-клеток в кишечнике. Arthritis Rheumatol. (2016) 68: 2646–61. DOI: 10.1002 / art.39783

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    23. Отт SJ, Musfeldt M, Wenderoth DF, Hampe J, Brant O, Folsch UR, et al. Снижение разнообразия бактериальной микрофлоры слизистой оболочки толстой кишки у пациентов с активным воспалительным заболеванием кишечника. Gut (2004) 53: 685–93.DOI: 10.1136 / gut.2003.025403

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    24. Pelaseyed T, Bergstrom JH, Gustafsson JK, Ermund A, Birchenough GM, Schutte A, et al. Слизь и муцины бокаловидных клеток и энтероцитов обеспечивают первую линию защиты желудочно-кишечного тракта и взаимодействуют с иммунной системой. Immunol Rev. (2014) 260: 8–20. DOI: 10.1111 / imr.12182

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    25.Селла М., Фукс А., Верми В., Факкетти Ф., Отеро К., Леннерц Дж. К. и др. Подмножество естественных клеток-киллеров человека является врожденным источником IL-22 для иммунитета слизистой оболочки. Nature (2009) 457: 722–5. DOI: 10.1038 / nature07537

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    26. Такатори Х., Канно Й., Уотфорд В.Т., Тато С.М., Вайс Г., Иванов II и др. Клетки, подобные индукторам лимфоидной ткани, являются врожденным источником IL-17 и IL-22. J Exp Med. (2009) 206: 35–41. DOI: 10.1084 / jem.20072713

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    27. Иванов И.И., Фрутос Рде Л., Манель Н., Йошинага К., Рифкин Д.Б., Сартор РБ и др. Специфическая микробиота направляет дифференцировку Т-хелперных клеток, продуцирующих ИЛ-17, в слизистой оболочке тонкой кишки. Cell Host Microbe (2008) 4: 337–49. DOI: 10.1016 / j.chom.2008.09.009

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    28. Аннунциато Ф, Косми Л., Лиотта Ф, Магги Э, Романьяни С.Фенотип человеческих клеток Th27 и их предшественников, цитокины, которые опосредуют их дифференцировку, и роль клеток Th27 в воспалении. Int Immunol. (2008) 20: 1361–8. DOI: 10.1093 / intimm / dxn106

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    29. Велдхоэн М., Хирота К., Вестендорф А.М., Буэр Дж., Дюмутье Л., Рено Дж. К. и др. Арилуглеводородный рецептор связывает опосредованный Th27 клетками аутоиммунитет с токсинами окружающей среды. Nature (2008) 453: 106–9.DOI: 10.1038 / nature06881

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    30. Hueber W., Sands BE, Lewitzky S, Vandemeulebroecke M, Reinisch W., Higgins PD, et al. Секукинумаб, человеческое моноклональное антитело против IL-17A, для лечения умеренной и тяжелой болезни Крона: неожиданные результаты рандомизированного двойного слепого плацебо-контролируемого исследования. Кишечник (2012) 61: 1693–700. DOI: 10.1136 / gutjnl-2011-301668

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    31.Ли Дж. С., Тато С. М., Джойс-Шейх Б., Гюлен М. Ф., Каятте С., Чен Ю. и др. Продукция IL-17, независимая от интерлейкина-23, регулирует проницаемость кишечного эпителия. Иммунитет (2015) 43: 727–38. DOI: 10.1016 / j.immuni.2015.09.003

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    32. О’Коннор В.Д., Каманака М., Бут С.Дж., Таун Т., Накаэ С., Ивакура И. и др. Защитная функция интерлейкина 17А при Т-клеточном воспалении кишечника. Nat Immunol. (2009) 10: 603–9.DOI: 10.1038 / ni.1736

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    33. Аннунциато Ф., Косми Л., Сантарласки В., Магги Л., Лиотта Ф., Мазинги Б. и др. Фенотипические и функциональные особенности клеток Th27 человека. J Exp Med. (2007) 204: 1849–61. DOI: 10.1084 / jem.20070663

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    34. Танака К., Мартинес Г.Дж., Ян Х, Лонг В., Ичияма К., Чи Х и др. Регуляция дифференцировки патогенных клеток T Helper 17 коактиватором-3 стероидных рецепторов. Cell Rep. (2018) 23: 2318–29. DOI: 10.1016 / j.celrep.2018.04.088

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    35. Gagliani N, Amezcua Vesely MC, Iseppon A, Brockmann L, Xu H, Palm NW, et al. Клетки Th27 трансдифференцируются в регуляторные Т-клетки во время разрешения воспаления. Nature (2015) 523: 221–5. DOI: 10.1038 / природа14452

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    36. Хайнеманн С., Хейнк С., Петерманн Ф., Васантакумар А., Ротхаммер В., Дордуин Е. и др.IL-27 и IL-12 противостоят провоспалительному IL-23 в CD4 + Т-клетках, индуцируя Blimp1. Nat Commun. (2014) 5: 3770. DOI: 10.1038 / ncomms4770

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    37. Гаглиани Н., Маньяни С.Ф., Хубер С., Джанолини М.Э., Пала М., Ликона-Лимон П. и др. Коэкспрессия CD49b и LAG-3 позволяет идентифицировать регуляторные Т-клетки 1 типа человека и мыши. Nat Med. (2013) 19: 739–46. DOI: 10,1038 / нм. 3179

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    38.Huber S, Gagliani N, Esplugues E, O’Connor WJr, Huber FJ, Chaudhry A, et al. Клетки Th27 экспрессируют рецептор интерлейкина-10 и контролируются Foxp3 (-) и Foxp3 + регуляторными Т-клетками CD4 + интерлейкин-10-зависимым образом. Иммунитет (2011) 34: 554–65. DOI: 10.1016 / j.immuni.2011.01.020

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    39. Гилл С.Р., Поп М., Дебой Р.Т., Экбург П.Б., Тернбо П.Дж., Самуэль Б.С. и др. Метагеномный анализ микробиома дистального отдела кишечника человека. Science (2006) 312: 1355–9. DOI: 10.1126 / science.1124234

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    40. Ли Дж., Цзя Х., Цай Х, Чжун Х., Фенг Кью, Сунагава С. и др. Интегрированный каталог эталонных генов микробиома кишечника человека. Nat Biotechnol. (2014) 32: 834–41. DOI: 10.1038 / NBT.2942

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    45. Инагаки Х., Сузуки Т., Номото К., Йошикай Ю. Повышенная восприимчивость к первичной инфекции Listeria monocytogenes у стерильных мышей может быть связана с отсутствием накопления L-селектина + CD44 + Т-клеток в очагах воспаления . Инфекционный иммунитет (1996) 64: 3280–7.

    PubMed Аннотация | Google Scholar

    46. Захар З., Сэвидж, округ Колумбия. Микробное вмешательство и колонизация желудочно-кишечного тракта мышей Listeria monocytogenes. Инфекционный иммунитет (1979) 23: 168–74.

    PubMed Аннотация | Google Scholar

    48. Пелокин Дж. М., Гоэль Дж., Виллабланка Е. Дж., Ксавье Р. Дж. Механизмы воспалительных заболеваний кишечника у детей. Ann Rev Immunol. (2016) 34: 31–64.DOI: 10.1146 / аннурев-иммунол-032414-112151

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    49. Sorini C, Cardoso RF, Gagliani N, Villablanca EJ. Комменсальные бактерии, специфичные для CD4 + , Т-клеточные ответы на здоровье и болезнь. Front Immunol. (2018) 9: 2667. DOI: 10.3389 / fimmu.2018.02667

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    50. Амре Д.К., Д’Суза С., Морган К., Зайдман Дж., Ламбретт П., Гримар Дж. И др.Дисбаланс в потреблении жирных кислот, овощей и фруктов с пищей связан с риском развития болезни Крона у детей. Am J Gastroenterol. (2007) 102: 2016–25. DOI: 10.1111 / j.1572-0241.2007.01411.x

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    51. Лофтус Э.В. мл. (2004). Клиническая эпидемиология воспалительного заболевания кишечника: заболеваемость, распространенность и влияние окружающей среды. Гастроэнтерология 126, 1504–1517. DOI: 10.1053 / j.гастро.2004.01.063

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    53. Хагикия А., Йорг С., Душа А., Берг Дж., Манзель А., Вашбиш А. и др. Пищевые жирные кислоты напрямую влияют на аутоиммунитет центральной нервной системы через тонкий кишечник. Иммунитет (2015) 43: 817–29. DOI: 10.1016 / j.immuni.2015.09.007

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    54. Миранда П.М., Де Пальма Дж., Серкис В., Лу Дж., Луи-Огюст М. П., Маккарвилл Дж. Л. и др.Диета с высоким содержанием соли обостряет колит у мышей, снижая уровень Lactobacillus и производство бутирата. Микробиом (2018) 6:57. DOI: 10.1186 / s40168-018-0433-4

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    57. Хоу Дж. К., Абрахам Б., Эль-Сераг Х. Диетическое потребление и риск развития воспалительного заболевания кишечника: систематический обзор литературы. Am J Gastroenterol. (2011) 106: 563–73. DOI: 10.1038 / ajg.2011.44

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    58.Мейер К.А., Куши Л.Х., Джейкобс Д.Р.-Дж., Славин Дж., Селлерс Т.А., Фолсом А.Р. Углеводы, пищевые волокна и диабет 2 типа у пожилых женщин. Am J Clin Nutr. (2000) 71: 921–30. DOI: 10.1093 / ajcn / 71.4.921

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    59. Ваннамэти С.Г., Whincup PH, Томас М.К., Саттар Н. Связь между диетической клетчаткой и воспалением, функцией печени и риском диабета 2 типа у пожилых мужчин: потенциальные механизмы воздействия клетчатки на риск диабета. Уход за диабетом (2009) 32: 1823–5. DOI: 10.2337 / dc09-0477

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    61. Миллер Т.Л., Волин М.Дж. Пути образования ацетата, пропионата и бутирата фекальной микробной флорой человека. Appl Environ Microbiol. (1996) 62: 1589–92.

    PubMed Аннотация | Google Scholar

    62. Ле Пол Э., Луазон С., Струиф С., Спрингель Дж.Й., Ланнуа В., Декобек М.Э. и др. Функциональная характеристика человеческих рецепторов жирных кислот с короткой цепью и их роль в активации полиморфно-ядерных клеток. J Biol Chem. (2003) 278: 25481–9. DOI: 10.1074 / jbc.M301403200

    CrossRef Полный текст | Google Scholar

    63. Desai MS, Seekatz AM, Koropatkin NM, Kamada N, Hickey CA, Wolter M, et al. Микробиота кишечника, лишенная пищевых волокон, разрушает слизистый барьер толстой кишки и повышает восприимчивость к патогенам. Cell (2016) 167: 1339–53.e1321. DOI: 10.1016 / j.cell.2016.10.043

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    64. Ким К.А., Гу В, Ли И.А., Джон Э.Х., Ким Д.Х.Микробиота кишечника, вызванная диетой с высоким содержанием жиров, усугубляет воспаление и ожирение у мышей через сигнальный путь TLR4. PLoS ONE (2012) 7: e47713. DOI: 10.1371 / journal.pone.0047713

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    65. Лю З., Брукс Р.С., Чаппио Э.Д., Ким С.Дж., Кротт Дж.В., Беннетт Дж. И др. Ожирение, вызванное диетой, увеличивает уровень TNF-альфа в толстой кишке у мышей и сопровождается активацией передачи сигналов Wnt: механизма колоректального рака, связанного с ожирением. J Nutr Biochem. (2012) 23: 1207–13. DOI: 10.1016 / j.jnutbio.2011.07.002

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    66. Murakami Y, Tanabe S, Suzuki T. Гиперпроницаемость кишечника, вызванная диетой с высоким содержанием жиров, связана с повышенным содержанием желчных кислот в толстом кишечнике мышей. J Food Sci. (2016) 81: h316–222. DOI: 10.1111 / 1750-3841.13166

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    67. Гулхан М., Мюррей Л., Лурье Р., Тонг Х., Шэн Ю.Х., Ван Р. и др.Диеты с высоким содержанием жиров вызывают стресс эпителиальных клеток толстой кишки и воспаление, которое нейтрализуется IL-22. Научный доклад (2016) 6: 28990. DOI: 10.1038 / srep28990

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    68. Schroeder BO, Birchenough GMH, Stahlman M, Arike L, Johansson MEV, Hansson GC, et al. Бифидобактерии или клетчатка защищают от вызванного диетой разрушения слизи толстой кишки, опосредованного микробиотой. Cell Host Microbe (2018) 23: 27–40.e27. DOI: 10.1016 / j.chom.2017.11.004

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    69. Девкота С., Ван И, Муш М. В., Леоне В., Фелнер-Пич Х, Надимпалли А. и др. Таурохолевая кислота, индуцированная пищевым жиром, способствует размножению патобионтов и колиту у мышей Il10 — / -. Nature (2012) 487: 104–8. DOI: 10.1038 / природа11225

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    70. Hildebrandt MA, Hoffmann C, Sherrill-Mix SA, Keilbaugh SA, Hamady M, Chen YY, et al.Диета с высоким содержанием жиров определяет состав микробиома кишечника мышей независимо от ожирения. Гастроэнтерология (2009) 137: 1716–24.e1711–1712. DOI: 10.1053 / j.gastro.2009.08.042

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    71. Агус А., Денизот Дж., Тевено Дж., Мартинес-Медина М., Массье С., Сованет П. и др. Западная диета вызывает изменение состава микробиоты, повышая восприимчивость к адгезивно-инвазивной инфекции E. coli и воспалению кишечника. Научный доклад (2016) 6: 19032. DOI: 10.1038 / srep19032

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    72. Мартинес-Медина М., Денизот Дж., Дре Н., Робин Ф., Биллард Э., Боннет Р. и др. Западная диета вызывает дисбактериоз с увеличением E. coli у мышей CEABAC10, изменяет барьерную функцию хозяина, способствуя колонизации AIEC. Gut (2014) 63: 116–24. DOI: 10.1136 / gutjnl-2012-304119

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    73.Эрнандес А.Л., Китц А., Ву С., Лоутер Д.Э., Родригес Д.М., Вудатту Н. и др. Хлорид натрия подавляет подавляющую функцию регуляторных Т-клеток FOXP3 + . J Clin Invest. (2015) 125: 4212–22. DOI: 10.1172 / JCI81151

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    74. Progatzky F, Sangha NJ, Yoshida N, McBrien M, Cheung J, Shia A, et al. Диетический холестерин напрямую вызывает острое воспаление кишечника, зависящее от воспаления кишечника. Nat Commun. (2014) 5: 5864. DOI: 10.1038 / ncomms6864

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    75. Ито А., Хонг К., Ока К., Салазар СП, Дил С., Витцтум Дж. Л. и др. Накопление холестерина в иммунных клетках CD11c (+) является причинным и целевым фактором аутоиммунного заболевания. Иммунитет (2016) 45: 1311–26. DOI: 10.1016 / j.immuni.2016.11.008

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    77. Morin CL, Eckel RH, Marcel T, Pagliassotti MJ.Диеты с высоким содержанием жиров повышают активность фактора альфа некроза опухолей жировой ткани. Эндокринология (1997) 138: 4665–71. DOI: 10.1210 / endo.138.11.5519

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    78. Chassaing B, Srinivasan G, Delgado MA, Young AN, Gewirtz AT, Vijay-Kumar M. Фекальный липокалин 2, чувствительный и широко динамичный неинвазивный биомаркер кишечного воспаления. PLoS ONE (2012) 7: e44328. DOI: 10.1371 / journal.pone.0044328

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    79.Cani PD, Amar J, Iglesias MA, Poggi M, Knauf C, Bastelica D и др. Метаболическая эндотоксемия вызывает ожирение и инсулинорезистентность. Диабет (2007) 56: 1761–72. DOI: 10.2337 / db06-1491

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    80. Пендяла С., Уокер Дж. М., Холт ПР. Диета с высоким содержанием жиров связана с эндотоксемией кишечника. Гастроэнтерология (2012) 142: 1100–1101.e1102. DOI: 10.1053 / j.gastro.2012.01.034

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    81.Соруш П., Ву Дж., Сюэ Х, Сонг Дж., Саттон С.В., Саблад М. и др. Оксистерины являются агонистами лиганда RORgammat и управляют дифференцировкой клеток Th27. Proc Natl Acad Sci USA. (2014) 111: 12163–8. DOI: 10.1073 / pnas.1322807111

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    82. Цуй Г, Цинь Икс, Ву Л, Чжан И, Шэн Х, Ю Цюй и др. Рецептор X печени (LXR) опосредует негативную регуляцию дифференцировки Th27 мыши и человека. J Clin Invest. (2011) 121: 658–70.DOI: 10.1172 / JCI42974

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    84. Feng Z, Long W, Hao B, Ding D, Ma X, Zhao L, et al. Штамм Bilophila wadsworthia, полученный из стула человека, вызывал системное воспаление у мышей, свободных от специфических патогенов. Gut Pathog. (2017) 9:59. DOI: 10.1186 / s13099-017-0208-7

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    85. Барон EJ, Summanen P, Downes J, Roberts MC, Wexler H, Finegold SM. Bilophila wadsworthia, gen.nov и sp nov, уникальный грамотрицательный анаэробный стержень, извлеченный из образцов аппендицита и человеческих фекалий. J General Microbiol. (1989) 135: 3405–11.

    PubMed Аннотация | Google Scholar

    86. Manichanh C., Rigottier-Gois L, Bonnaud E, Gloux K, Pelletier E, Frangeul L, et al. Снижение разнообразия фекальной микробиоты при болезни Крона, выявленное с помощью метагеномного подхода. Кишечник (2006) 55: 205–11. DOI: 10.1136 / gut.2005.073817

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    87.Aggarwal S, Ghilardi N, Xie MH, de Sauvage FJ, Gurney AL. Интерлейкин-23 способствует определенному состоянию активации CD4 Т-клеток, характеризующемуся продуцированием интерлейкина-17. J Biol Chem. (2003) 278: 1910–4. DOI: 10.1074 / jbc.M207577200

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    88. Чжоу Л., Иванов И.И., Спольски Р., Мин Р., Шендеров К., Эгава Т. и др. IL-6 программирует дифференцировку клеток T (H) -17, способствуя последовательному включению путей IL-21 и IL-23. Nat Immunol. (2007) 8: 967–74. DOI: 10.1038 / ni1488

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    89. Kuntzsch D, Bergann T, Dames P, Fromm A, Fromm M, Davis RA, et al. Агонист глюкокортикоидных рецепторов растительного происхождения Эндиандрин А действует как костимулятор натриевых каналов эпителия толстой кишки (ENaC) через SGK-1 и MAPK. PLoS ONE (2012) 7: e49426. DOI: 10.1371 / journal.pone.0049426

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    90.Wulff P, Vallon V, Huang DY, Volkl H, Yu F, Richter K и др. Нарушение удержания Na (+) в почках у мышей с нокаутом sgk1. J Clin Invest. (2002) 110: 1263–8. DOI: 10.1172 / JCI0215696

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    91. Ян Й., Торчинский М.Б., Гоберт М., Сюн Х., Сюй М., Линехан Д.Л. и др. Сфокусированная специфичность кишечных клеток Th27 по отношению к комменсальным бактериальным антигенам. Nature (2014) 510: 152–6. DOI: 10.1038 / природа13279

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    92.Фурусава Ю., Обата Ю., Фукуда С., Эндо Т.А., Накато Г., Такахаши Д. и др. Бутират комменсального микроба индуцирует дифференцировку регуляторных Т-клеток толстой кишки. Nature (2013) 504: 446–50. DOI: 10.1038 / природа12721

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    93. Смит П.М., Ховитт М.Р., Паников Н., Мишо М., Галлини К.А., Бохлули Ю.М. и др. Микробные метаболиты, короткоцепочечные жирные кислоты, регулируют гомеостаз Treg-клеток толстой кишки. Science (2013) 341: 569–73.DOI: 10.1126 / science.1241165

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    94. Schulz MD, Atay C, Heringer J, Romrig FK, Schwitalla S, Aydin B, et al. Дисбиоз, опосредованный диетой с высоким содержанием жиров, способствует канцерогенезу кишечника независимо от ожирения. Nature (2014) 514: 508–12. DOI: 10.1038 / природа13398

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    95. Арпайя Н., Кэмпбелл С., Фан Х, Дикий С., ван дер Викен Дж., ДеРоос П. и др.Метаболиты, продуцируемые комменсальными бактериями, способствуют образованию периферических регуляторных Т-клеток. Nature (2013) 504: 451–5. DOI: 10.1038 / природа12726

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    96. Пак Дж., Ким М., Канг С.Г., Джаннаш А.Х., Купер Б., Паттерсон Дж. И др. Короткоцепочечные жирные кислоты индуцируют как эффекторные, так и регуляторные Т-клетки путем подавления гистоновых деацетилаз и регуляции пути mTOR-S6K. Mucosal Immunol. (2015) 8: 80–93.DOI: 10,1038 / mi.2014.44

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    97. Кимура А., Нака Т., Нохара К., Фуджи-Курияма Ю., Кишимото Т. Арилуглеводородный рецептор регулирует активацию Stat1 и участвует в развитии клеток Th27. Proc Natl Acad Sci USA. (2008) 105: 9721–6. DOI: 10.1073 / pnas.0804231105

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    98. Bai A, Lu N, Guo Y, Liu Z, Chen J, Peng Z. Полностью транс-ретиноевая кислота подавляет воспалительные реакции, сдвигая профиль Treg / Th27 при язвенном колите человека и мышином колите. J Leukocyte Biol. (2009) 86: 959–69. DOI: 10.1189 / jlb.0109006

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    99. Hong K, Zhang Y, Guo Y, Xie J, Wang J, He X, et al. Полностью транс-ретиноевая кислота ослабляет экспериментальный колит за счет ингибирования передачи сигналов NF-kappaB. Immunol Lett. (2014) 162: 34–40. DOI: 10.1016 / j.imlet.2014.06.011

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    100. Муцида Д., Парк Й., Ким Г., Туровская О., Скотт И., Кроненберг М. и др.Реципрокная дифференцировка Th27 и регуляторных Т-клеток, опосредованная ретиноевой кислотой. Science (2007) 317: 256–60. DOI: 10.1126 / science.1145697

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    101. Сяо С., Цзинь Х., Корн Т., Лю С.М., Оукка М., Лим Б. и др. Ретиноевая кислота увеличивает Foxp3 + регуляторные Т-клетки и ингибирует развитие клеток Th27 за счет усиления управляемой TGF-бета передачи сигналов Smad3 и ингибирования экспрессии рецепторов IL-6 и IL-23. J Immunol. (2008) 181, 2277–84. DOI: 10.4049 / jimmunol.181.4.2277

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    102. Ивата М., Хиракияма А., Эшима Ю., Кагечика Х, Като С., Сон С. Ретиноевая кислота накладывает отпечаток специфичности на Т-лимфоциты по отношению к кишечнику. Иммунитет (2004) 21: 527–38. DOI: 10.1016 / j.immuni.2004.08.011

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    103. Chang SH, Chung Y, Dong C. Витамин D подавляет продукцию цитокинов Th27, индуцируя экспрессию гомологичного белка C / EBP (CHOP). J Biol Chem. (2010) 285: 38751–5. DOI: 10.1074 / jbc.C110.185777

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    104. Гарг М., Хенди П., Динг Дж., Шоу С., Холд Г., Харт А. Влияние витамина D на воспаление кишечника и фекальную микробиоту у пациентов с язвенным колитом. Колит Дж. Крона (2018) 12: 963–972. DOI: 10.1093 / ecco-jcc / jjy052

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    105. Котийяр А., Кеннеди С.П., Конг Л.С., Прифти Е., Понс Н., Ле Шателье Е. и др.Диетическое вмешательство влияет на богатство кишечных микробов. Nature (2013) 500: 585–8. DOI: 10.1038 / природа12480

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    106. Ле Шателье Э, Нильсен Т., Цинь Дж., Прифти Э, Хильдебранд Ф., Фалони Дж. И др. Богатство микробиома кишечника человека коррелирует с метаболическими маркерами. Nature (2013) 500: 541–6. DOI: 10.1038 / nature12506

    CrossRef Полный текст | Google Scholar

    107. Буркин Л.Д., Титгемайер Е.С., Фэи Г.С.-младший.Ферментация растительных волокон фекальными бактериями человека: исчезновение полисахаридов клеточной стенки и образование короткоцепочечных жирных кислот во время ферментации in vitro и водоудерживающая способность неферментированных остатков. J Nutr. (1993) 123: 860–9. DOI: 10.1093 / jn / 123.5.860

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    109. Родригес-Кабесас М.Э., Гальвес Дж., Камуэско Д., Лоренте М.Д., Конча А., Мартинес-Огюстин О. и др. Кишечная противовоспалительная активность пищевых волокон (семена Plantago ovata) у трансгенных крыс HLA-B27. Clin Nutr. (2003) 22: 463–71. DOI: 10.1016 / S0261-5614 (03) 00045-1

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    110. Эрл К.А., Биллингс Дж., Сигал М., Лихтман Дж. С., Ханссон Г. К., Элиас Дж. Э. и др. Количественная визуализация пространственной организации кишечной микробиоты. Cell Host Microbe (2015) 18: 478–88. DOI: 10.1016 / j.chom.2015.09.002

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    111. Hryckowian AJ, Van Treuren W., Smits SA, Davis NM, Gardner JO, Bouley DM, et al.Углеводы, доступные для микробиоты, подавляют инфекцию Clostridium difficile на мышиной модели. Nat Microbiol. (2018) 3: 662–9. DOI: 10.1038 / s41564-018-0150-6

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    112. Ким М., Фризен Л., Пак Дж., Ким Х.М., Ким Ч. Микробные метаболиты, короткоцепочечные жирные кислоты сдерживают бактериальную нагрузку на ткани, хроническое воспаление и связанный с ним рак в толстой кишке мышей. евро J Immunol. (2018) 48: 1235–47.DOI: 10.1002 / eji.201747122

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    113. Ким М.Х., Кан С.Г., Пак Дж.Х., Янагисава М., Ким СН. Короткоцепочечные жирные кислоты активируют GPR41 и GPR43 на эпителиальных клетках кишечника, чтобы стимулировать воспалительные реакции у мышей. Гастроэнтерология (2013) 145: 396–406.e391 – e310. DOI: 10.1053 / j.gastro.2013.04.056

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    114. Д’Суза С., Леви Е., Мак Д., Исраэль Д., Ламбретт П., Гадириан П. и др.Особенности питания и риск болезни Крона у детей. Воспаление кишечника. (2008) 14: 367–73. DOI: 10.1002 / ibd.20333

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    115. Li Y, Innocentin S, Withers DR, Roberts NA, Gallagher AR, Grigorieva EF, et al. Экзогенные стимулы поддерживают интраэпителиальные лимфоциты за счет активации рецепторов арилуглеводородов. Cell (2011) 147: 629–40. DOI: 10.1016 / j.cell.2011.09.025

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    116.Накахама Т., Хани Х., Нгуен Н.Т., Чинен И., Рипли Б., Миллин Д. и др. Опосредованная арилуглеводородным рецептором индукция кластера микроРНК-132/212 способствует дифференцировке Т-хелперных клеток, продуцирующих интерлейкин-17. Proc Natl Acad Sci USA. (2013) 110: 11964–9. DOI: 10.1073 / pnas.1311087110

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    117. Qiu J, Heller JJ, Guo X, Chen ZM, Fish K, Fu YX, et al. Рецептор арилуглеводородов регулирует иммунитет кишечника путем модуляции врожденных лимфоидных клеток. Иммунитет (2012) 36: 92–104. DOI: 10.1016 / j.immuni.2011.11.011

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    118. Цю Дж., Го Х, Чен З.М., Хе Л., Зонненберг Г.Ф., Артис Д. и др. Врожденные лимфоидные клетки группы 3 ингибируют опосредованное Т-клетками воспаление кишечника посредством передачи сигналов арилуглеводородным рецептором и регуляции микрофлоры. Иммунитет (2013) 39: 386–99. DOI: 10.1016 / j.immuni.2013.08.002

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    119.Харрисон Э. Механизмы, участвующие в кишечной абсорбции витамина А и каротиноидов провитамина А. Biochim Biophys Acta (2012) 1821: 70–7. DOI: 10.1016 / j.bbalip.2011.06.002

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    120. Виллабланка Э.Дж., Ван С., де Калисто Дж., Гомеш, округ Колумбия, Кейн М.А., Неаполь Д.Л. и др. Сигнальные пути MyD88 и ретиноевой кислоты взаимодействуют, чтобы модулировать желудочно-кишечные активности дендритных клеток. Гастроэнтерология (2011) 141: 176–85.DOI: 10.1053 / j.gastro.2011.04.010

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    122. Теджон Г., Манрикес В., Де Калисто Дж., Флорес-Сантибанес Ф., Идальго И., Крисостомо Н. и др. Витамин А нарушает перепрограммирование Treg в клетки, продуцирующие IL-17, во время воспаления кишечника. BioMed Res Int. (2015) 2015: 137893. DOI: 10.1155 / 2015/137893

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    123. Симмонс Дж. Д., Маллиган К., Уэльс Ки, Джуэлл Д. П..Полиморфизм гена рецептора витамина D: связь с восприимчивостью к болезни Крона. Кишечник (2000) 47: 211–4. DOI: 10.1136 / gut.47.2.211

    PubMed Аннотация | CrossRef Полный текст | Google Scholar

    Иммунитет в кишечнике | Британское общество иммунологии

    Эндрю М. Платт, Университет Глазго, Великобритания

    В толстой кишке (ободочной кишке) проживает большая популяция микробиоты, состоящая как минимум из 10 12 организмов на грамм содержимого просвета.Эти организмы, вместе с антигенной нагрузкой, обеспечиваемой диетой, и постоянной угрозой со стороны потенциальных патогенов, означает, что иммунная система кишечника встречает больше антигена, чем любая другая часть тела.

    Весы

    Поскольку многие патогены попадают в организм через слизистую оболочку кишечника, жизненно важно, чтобы лимфоидные ткани, связанные с кишечником, могли обеспечивать эффективный иммунный ответ, когда это необходимо. Однако несоответствующие реакции на безобидную пищу и комменсальные антигены приводят к воспалительным расстройствам, таким как целиакия и воспалительное заболевание кишечника ( IBD ).

    Кишечная лимфоидная ткань (GALT)

    Лимфоидные элементы кишечника включают организованные лимфоидные ткани, такие как пятна Пейера (PP) и брыжеечные лимфатические узлы (MLN). Эффекторными участками кишечника являются эпителий слизистой оболочки и лежащая в основе собственная пластинка (LP). Здесь есть много различных иммунных клеток, включая активированные Т-клетки, плазматические клетки, тучные клетки, дендритные клетки и макрофагов ( Рисунок 1 ) даже в нормальных условиях.То, что это не приводит к явной патологии тканей, отражает тот факт, что присутствующие эффекторные клетки активно контролируются мощными регуляторными механизмами.

    Рис. 1. Макрофаги (F4 / 80 +; красный) в большом количестве в покоящейся LP толстой кишки

    Иммунная защита кишечника

    Хотя эпителий кишечника состоит только из одного слоя клеток, он образует барьер против проникновения микробов. Нарушения барьерной функции способствуют развитию и сохранению воспаления при ВЗК.Эпителиальные клетки тонкой кишки покрыты гликокаликсом из , муцинов, и других гликопротеинов, которые могут взаимодействовать с бактериями и задерживать их в слизи. Кроме того, антимикробные пептиды, такие как дефенсины , секретируются клетками Панета, расположенными на дне кишечных крипт. Эпителиальные клетки также действуют как микробных сенсоров , секретируя такие факторы, как IL-8, MCP-1, RANTES, TNFa и IL-6, в ответ на проникновение бактерий. Это приводит к привлечению нейтрофилов, эозинофилов, моноцитов, , фагоцитарных макрофагов, и Т-клеток, и, таким образом, усиливает индукцию защитного иммунитета.Хотя многие из этих клеток также присутствуют в нормальном кишечнике, в физиологических условиях они обусловлены факторами местной среды , чтобы быть невоспалительными . Нормальный и воспаленный кишечник содержит множество специфических иммунных клеток, включая IgA-секретирующие плазматические клетки, CD4 + и CD8 + Т-клетки , регуляторные Т-клетки и g dT-клетки .

    Рисунок 2 . Иммунная регуляция против прайминга

    Комменсальные бактерии и патогены имеют много общих факторов, которые могут быть обнаружены рецепторами распознавания патогенов, такими как toll-подобные рецепторы ( TLR ).Так как же комменсалы не вызывают воспалительные реакции (см. Также , рис. 2, )?

    • Модуляция врожденных активирующих рецепторов, таких как CD14 и CD89, на макрофагах кишечника.
    • Высокий уровень иммуномодулирующих факторов: IL-10, TGFb, TSLP, ретиноевая кислота, которые могут «кондиционировать» местные клетки.
    • Пониженная функция TLR в кишечном ДК.
    • Комменсалы — неинвазивные . В то время как патогены проникают в эпителий и вызывают воспалительные реакции как локально, так и в более широком масштабе, комменсальные бактерии проникают в эпителий только после поглощения местными DC и затем транспортируются в дренирующую MLN, где их развитие останавливается.Это приводит к выработке секреторного IgA в кишечнике, который ограничивает количество комменсалов, и регуляторных Т-клеток, которые подавляют воспалительные реакции. Местные невоспалительные макрофаги также заглатывают и убивают редкие попадающие комменсалы.

    © Авторские права на это произведение принадлежат автору

    Иммунитет кишечника млекопитающих

    Biomed J. Авторская рукопись; доступно в PMC 2016 15 января.

    Опубликован в окончательной отредактированной форме как:

    PMCID: PMC4714863

    NIHMSID: NIHMS609345

    Benoit Chassaing

    1 Центр исследований иммунитета, биомедицина Университет штата Джорджия, Атланта, Джорджия, США

    Маниш Кумар

    2 Департамент диетологии, Государственный университет Пенсильвании, Юниверсити Парк, Пенсильвания, США

    Марк Т.Baker

    3 Биологический факультет Университета штата Джорджия, Атланта, Джорджия, США

    Вишал Сингх

    2 Департамент диетологии Университета штата Пенсильвания, Юниверсити Парк, Пенсильвания, США

    Матам Виджай-Кумар

    2 Департамент диетологии, Государственный университет Пенсильвании, Юниверсити Парк, Пенсильвания, США

    4 Медицинский факультет, Медицинский колледж Государственного университета Пенсильвании, Херши, штат Пенсильвания, США

    1 Центр Воспаление, иммунитет и инфекция, Институт биомедицинских наук, Государственный университет Джорджии, Атланта, Джорджия, США

    2 Департамент диетологии, Государственный университет Пенсильвании, Юниверсити Парк, штат Пенсильвания, США

    3 Департамент биологии, Университет штата Джорджия, Атланта, Джорджия, США

    4 Медицинский факультет Колледжа Университета штата Пенсильвания Medicine, Hershey, PA, USA

    Для корреспонденции: Dr.Матам Виджай-Кумар, Департамент диетологии, Государственный университет Пенсильвании, Пенсильвания, США. 323, лаборатория Чандли, Юниверсити-Парк, Пенсильвания 16802, США. Тел: 814-8652786; Факс: 814-8636103; [email protected] См. другие статьи в PMC, в которых цитируется опубликованная статья.

    Abstract

    Кишечник млекопитающих является крупнейшим иммунным органом в организме и состоит из клеток негемопоэтического (эпителий, клетки Панета, бокаловидные клетки) и гемопоэтического (макрофаги, дендритные клетки, Т-клетки) происхождения, а также жилище для триллионов микробов, известных под общим названием микробиота.Гомеостаз этой большой микробной биомассы является необходимым условием для поддержания здоровья хозяина за счет максимизации благоприятных симбиотических отношений и сведения к минимуму рисков проживания в такой непосредственной близости. И микробиота, и иммунная система хозяина взаимодействуют друг с другом для взаимного поддержания гомеостаза в том, что можно назвать «отношениями любви и ненависти». Кроме того, врожденное и адаптивное иммунные ответвления иммунной системы хозяина взаимодействуют и компенсируют друг друга для поддержания равновесия в очень сложной экосистеме кишечника стабильным и строгим образом.Любой дисбаланс из-за врожденного или адаптивного иммунодефицита или аберрантного иммунного ответа может привести к дисбактериозу и слабому или сильному воспалению кишечника, что в конечном итоге приведет к метаболическим заболеваниям.

    Ключевые слова: врожденный иммунитет, микробиота, NOD-подобные рецепторы, рецепторы распознавания образов, толл-подобные рецепторы

    В кишечнике млекопитающих обитает большое количество бактерий, особенно в дистальном отделе кишечника, известных под общим названием микробиота. В последнее десятилетие всплеск исследований, описывающих важность кишечной микробиоты для здоровья и болезней хозяина, убедительно продемонстрировал, что колонизация разнообразной и стабильной микробиотой абсолютно необходима для правильного развития как врожденных, так и адаптивных ветвей иммунной системы.

    Большое количество недавних исследований показывает, что метаболические функции микробиоты существенны и сопоставимы по величине с функциями печени. Микробиота может, например, влиять на состав жирных кислот сетчатки и хрусталика глаза, влиять на плотность костей и способствовать васкуляризации кишечника. [1] Этот биореактор обеспечивает необходимые питательные вещества, такие как биотин и витамин К, и переваривает сложные пищевые волокна, образуя масляную кислоту, главный источник топлива для эпителия кишечника. [2] Эоны совместной эволюции, движимые общим интересом, сделали микробиоту партнером иммунной системы в борьбе с бактериальными патогенами. В частности, микробиота действует как устойчивый конкурент за пищу, пространство и места закрепления, тем самым исключая вторжение энтеропатогенов (устойчивость к колонизации). Напротив, два недавних исследования показывают, что микробиота способствует успешной передаче патогенных вирусов, [3,4] и множественные мышиные модели воспалительных заболеваний, от колита до артрита, требуют микробиоты кишечника.Кроме того, то, что состав микробиоты является определяющим фактором серьезности заболевания, указывает на то, что микробиота также может представлять серьезную угрозу для своего хозяина.

    Поддержание гомеостаза такой сложной экосистемы потребовало разработки специализированной «иммунной системы слизистой оболочки» (MIS), которая целесообразно обнаруживает и устраняет преходящие патогены, одновременно удерживая полезных условно-патогенных микроорганизмов на правильной стороне монослоя эпителия кишечника. Другими словами, существует постоянное взаимодействие между эпителием и микробиотой, так что эпителий хорошо подготовлен к ответу на любое вторжение благодаря своей способности секретировать множество хемоаттрактантов иммунных клеток (аналогично « To to make peace,». готовиться к войне »).Поскольку это должно быть сделано при минимизации вреда для полезных микробов и тканей хозяина, MIS разработала сложную систему связи с микробиотой, в значительной степени опосредованную toll-подобным рецептором (TLR) и распознаванием паттернов рецепторов, подобных домену олигомеризации нуклеотидов (NLR). рецепторы (PRR). Похоже, что как врожденная, так и адаптивная иммунные системы эволюционировали так, чтобы для их правильного развития требовались микробные взаимодействия, [5–7] , как схематично представлено на. Подтверждая это мнение, у стерильных мышей наблюдается пониженный уровень секреторного иммуноглобулина А в кишечнике (sIgA), дефекты развития лимфоидной ткани, ассоциированной с кишечником, а также более мелкие пейеровские бляшки и мезентериальные лимфатические узлы. [8] В этом обзоре мы описываем последние достижения в области MIS млекопитающих, уделяя особое внимание взаимодействию между клетками врожденного и адаптивного иммунитета и их эффекторными молекулами в гомеостазе микробиоты, поддержании толерантности и установлении соответствующего воспалительного / воспалительного процесса. иммунный ответ против возбудителя инсульта / вторжения.

    Иммунная система слизистой оболочки кишечника. В нормальном состоянии взаимодействия PRR и микробиоты приводят к секреции антимикробных пептидов и развитию лимфоидной ткани, ассоциированной с кишечником (GALT).Перекрестное взаимодействие между микробиотой и кишечной иммунной системой вызывает гомеостатические факторы, такие как IgA и дефенсины, которые поддерживают гомеостаз микробиоты и целостность эпителиального барьера.

    Физические и химические барьеры в кишечнике

    Кишечник млекопитающих является основным местом взаимодействия между иммунной системой хозяина и содержимым просвета, включая не только пищевые антигены и токсины, но и микробиоту. [9] Иммунитет слизистой оболочки начинается в эпителии, когда микробы сталкиваются с хозяином на поверхности эпителия слизистой оболочки, пытаясь колонизировать и закрепиться.Большинство этих микробов и их метаболитов исключены из внутреннего доступа к хозяину как физическими, так и химическими барьерами. Физические барьеры включают один слой эпителиальных клеток, их межклеточные плотные соединения и слизь, покрывающую эпителиальную поверхность. [9] Кроме того, физический барьер хорошо поддерживается тонким балансом химических барьеров, таких как кислотность (низкий pH), детергенты (соли желчных кислот), протеолитические ферменты (трипсин), ферменты, разрушающие клеточные стенки (лизоцим) и антибактериальные свойства. белки (дефенсины и др.), которые контролируют микробную популяцию. Кроме того, однонаправленные перистальтические движения кишечника также помогают предотвратить проникновение микробов из плотного дистального содержимого кишечника в тонкий кишечник.

    Слой слизи: смазывающий и улавливающий барьер

    Слой слизи, покрывающий эпителиальные поверхности, смазывает кишечный тракт. Он демонстрирует липкую гелеобразующую способность из-за своей жесткой белковой структуры и высокой когезии. Слизь может рассматриваться как первая линия физической защиты кишечника от микробных патогенов, помогающая улавливать беспокоящий микроб. [10,11] Муцины, основные компоненты слизистого слоя, секретируются бокаловидными клетками, которые разбросаны среди энтероцитов по всему эпителию. Муцины представляют собой высокомолекулярные (MW) гликопротеины с обширным гликозилированием и сахарными фрагментами, присоединенными к остаткам серина или треонина O -гликозидными связями. Изменения в составе муцина могут лежать в основе этиологии некоторых заболеваний, таких как язвенный колит и гастрит, вызванный Helicobacter pylori . [12]

    В настоящее время хорошо известно, что муцины также играют более непосредственную роль в борьбе с патогенами и паразитами, играя важную роль в скоординированном иммунном ответе на инфекцию. [13,14] Они также служат местом прикрепления микроорганизмов за счет взаимодействия между многими бактериальными компонентами. Однако сверхэкспрессия некоторых белков муцина приводит к раку, [15] , в то время как дефицит приводит к воспалению кишечника и колиту (MUC-2). [16] В последнее время бокаловидные клетки также участвуют в обеспечении оральной толерантности. [17] Это исследование показывает, что в устойчивом состоянии бокаловидные клетки тонкого кишечника функционируют как каналы, доставляющие растворимые антигены с низкой молекулярной массой из просвета кишечника в лежащие в основе иммунные клетки [дендритные клетки CD103 + lamina propria (DC)].Эта преимущественная доставка антигенов к DC с толерогенными свойствами подразумевает ключевую роль бокаловидных клеток в гомеостазе кишечника. [17] Недавно было показано, что у мышей с дефицитом специфической синтазы жирных кислот толстого эпителия (FAS), неспособных ацилировать MUC-2 пальмитиновой кислотой ( S -пальмитоилирование), что приводит к нарушению секреции и функции, проявляются нарушения в слизистом барьере кишечника, а также повышенная кишечная проницаемость, колит, системное воспаление и изменения микробной экологии кишечника. [18]

    Эпителиальный барьер: функция «хранителя ворот»

    Желудочно-кишечный эпителий образует критически важный интерфейс между внутренним хозяином и содержимым просвета. Большинство эпителиев представляют собой абсорбирующие клетки (энтероциты), которые также должны поддерживать параклеточный и трансклеточный транспорт питательных веществ, электролитов и воды. Энтероциты являются одними из наиболее быстро регенерирующих клеток в организме, которым соответствует высокая скорость апоптоза, позволяющая поддерживать гомеостаз эпителиальных клеток и позволяя эпителию быстро заживать после повреждения. [19,20] Барьер, образованный эпителием, поэтому должен быть строго регулируемым и избирательно проницаемым. Стабильность и функция эпителиального барьера зависит от комплекса белков, состоящих из различных межклеточных соединений, которые включают плотные соединения (окклюдная зона и клаудины), адгезивные соединения (E-кадгерин и β-катенин) и десмосомы. [21] Соответственно, проницаемость для различных питательных веществ варьируется на отдельных участках и проявляет региональные различия в конкретных транспортируемых питательных веществах и ионах.Эпителии также оснащены многочисленными насосами, которые помогают поддерживать однонаправленные / векторные молекулы секреции. Интересно, что у мышей с дефицитом насоса с множественной лекарственной устойчивостью 1 (MDR1), участвующего в перекачивании нескольких биологических молекул, развивается спонтанное воспаление кишечника, подобное воспалительному заболеванию кишечника человека (ВЗК), которое можно предотвратить с помощью лечения антибиотиками. [22,23]

    Прямая врожденная иммунная активность эпителия кишечника

    Известно, что эпителий не только является физическим барьером для микробов и содержимого просвета, но и секретирует различные молекулы, которые помогают поддерживать гомеостаз кишечника.Другими словами, кишечный эпителий можно рассматривать как «дополнительные клетки» MIS. Эпителии секретируют обширную группу цитокинов и хемокинов, которые регулируют хемотаксис иммунных клеток, таких как нейтрофилы, макрофаги, базофилы и Т-клетки. [24] Список эффекторных молекул, специфичных для эпителия, значительно расширяется благодаря развитию микроматриц и других чувствительных аналитических методов, в том числе технологии стерилизации микробов и Cre-рекомбиназы, а также химер костного мозга.Секреция цитокинов эпителиальными клетками кишечника (IEC) наблюдалась во множестве клеточных линий со значительным перекрытием цитокинов, секретируемых иммунными клетками. Даже если их секреция цитокинов меньше, чем секреция иммунных клеток (например, макрофагов), тот факт, что IEC являются наиболее многочисленными клетками на поверхности слизистой оболочки, предполагает, что их уровень секреции оказывает важное влияние на локальные концентрации цитокинов. Однако относительный вклад цитокинов IEC четко не выявлен.

    IEC секретируют ряд хемотаксических цитокинов (хемокинов), которые направляют хемотаксис и, таким образом, контролируют популяции слизистых оболочек как врожденных, так и адаптивных иммунных клеток. Хемокин эпителиального происхождения интерлейкин-8 (IL-8, CXCL8; эквивалент мышиный хемокин, полученный из кератиноцитов, KC) [25] и хемоаттрактанты эпителиальных нейтрофилов, включая аттрактант эпителиальных нейтрофилов-78 (ENA-78, CXCL5), [26 ] Gro-a (CXCL1) и Gro-b (CXCL2), [27] регулируют хемотаксис нейтрофилов.Например, секреция ENA-78 значительно задерживается, но длится дольше, чем секреция IL-8, что позволяет предположить особую роль этих хемокинов в ответе на патогены или воспалительные стимулы. Хемокины, секретируемые эпителием, включая хемотаксический белок моноцитов (MCP-1; CCL2), воспалительный белок макрофагов (MIP1α; CCL3) и RANTES / CC L5 (регулируемый при активации и предположительно секретируемый), в первую очередь регулируют рекрутирование моноцитов. MIP1α, по-видимому, играет важную роль в рекрутировании DC слизистой оболочки. [27]

    IEC также секретирует хемокины, которые стимулируют набор различных субпопуляций Т-клеток в слизистую оболочку. Эти хемокины имеют решающее значение для управления рекрутингом интраэпителиальных лимфоцитов (IEL) и включают индуцируемый интерфероном белок (IP-10), монокин, индуцированный интерфероном (IFN) -γ (Mig), и IFN-индуцируемый α-хемоаттрактант Т-клеток (I -TAC). [28] В отличие от нейтрофилов, IEL слизистой оболочки обычно присутствуют в слизистой оболочке, что согласуется с наблюдением, что хемоаттрактанты Т-клеток экспрессируются конститутивно. [29]

    Помимо организации набора различных иммунных клеток, IEC также секретируют ряд провоспалительных цитокинов, лучшими примерами которых являются фактор некроза опухоли (TNF) -α и IL-6. [30,31] Секреция этих цитокинов влияет на местное воспалительное состояние, а также оказывает существенное влияние на системные уровни цитокинов. Например, TNF-α является не только мощным усилителем других провоспалительных цитокинов и хемокинов, но также заставляет IEC производить провоспалительные ферменты, индуцируемые синтазой оксида азота (iNOS) и циклооксигеназой-2 (COX-2), и активирует нейтрофилы для генерации большего количества активные формы кислорода (АФК) и дегрануляция при встрече с патогенными раздражителями.Врожденная иммунная активность этих IEC в сотрудничестве с профессиональными иммунными клетками может оказывать существенное влияние как на микробиоту, так и на гомеостаз ткани хозяина.

    Помимо растворимых иммуномодуляторов, IEC также регулируют множество молекул адгезии, которые влияют на взаимодействие эпителия с инфильтрирующими иммунными клетками. Считается, что экспрессия лигандов нейтрофилов в IEC играет важную роль в регуляции адгезии и трансэпителиальной миграции (диапедез) нейтрофилов.В частности, была продемонстрирована ключевая роль эпителиального CD47 и сигнального регуляторного белка (SIRP) 1a в регуляции трансмиграции нейтрофилов. [32,33] Молекула внутриклеточной адгезии 1 (ICAM-1) заметно активируется при воспалительных состояниях и, возможно, играет роль в повышении адгезии нейтрофилов к эпителию, связанной с ВЗК. [34]

    IEC также известны как секретирующие растворимые рецепторы, которые могут нейтрализовать биоактивность провоспалительных цитокинов.Например, активация инфламмасом приводит к секреции мощных провоспалительных цитокинов IL-1β и IL-18. Биологическая активность цитокинов инфламмасом тонко регулируется экспрессией эндогенных, конститутивно экспрессируемых растворимых белков-ингибиторов. Действительно, отсутствие этих антицитокинов приводит к неконтролируемому воспалению, которое вызывает повреждение тканей хозяина. [35] Хорошо изученным примером регуляции цитокинов инфламмасом является секреторный антагонист рецептора IL-1 (sIL-1Ra), который конкурирует с IL-1β за свой рецептор, тем самым ослабляя биоактивность этого мощного провоспалительного цитокина.Экспрессия IEC sIL-1Ra может быть индуцирована провоспалительными стимулами, такими как сам IL-1β и липополисахарид (LPS), а также различными иммуномодуляторами, такими как гранулоцитарно-макрофагальный колониестимулирующий фактор (GM-CSF), IFN-β. , IFN-γ и флагеллин. [36–38] Важно отметить, что sIL-1Ra экспрессируется гораздо шире, чем IL-1β, что позволяет клеткам, которые не производят IL-1β, играть роль в регуляции его активности. Точно так же эпителий может индуцировать IL-18-связывающий белок (IL-18BP) в ответ на провоспалительный цитокин IFN-γ, который является мощным ингибитором IL-18. [38]

    Ключевым аспектом роли эпителия в MIS является его способность тонко регулировать функцию и активацию иммунных клеток. Следовательно, активация и возврат в нормальное состояние должны быть тесно связаны. Например, неспособность быстро набирать иммунные клетки в ответ на патогены может сделать хозяина более восприимчивым к системной инфекции (например, мышей с дефицитом MyD88, обсуждаемых ниже). И наоборот, чрезмерное и неконтролируемое рекрутирование, особенно нейтрофилов, вероятно, будет пагубным, поскольку оно может привести к значительному повреждению ткани хозяина, как это наблюдается при хронической ВЗК.Таким образом, IEC осуществляют жесткий контроль над своими иммуномодулирующими генами MIS, особенно связанными с рекрутированием иммунных клеток, такими как нейтрофильный хемоаттрактант IL-8.

    Микроскладчатые клетки

    Другой структурно отличающийся тип эпителиальных клеток — это клетки микроскладок (М), характеризующиеся микроскладкой плазматической мембраной. Эти клетки являются иммунологическими дозорами, играющими важную роль в адаптивном иммунитете слизистых оболочек. [39] Они считаются специализированным эпителием и присутствуют на поверхности В-клеточных фолликулов [пятна Пейера и изолированные лимфоидные фолликулы (ILF)].Это основные клетки, отвечающие за отбор проб кишечной микробиоты и патогенов. [40] Структурно М-клетки имеют более короткие / скудные микроворсинки и гораздо меньше гликокаликса на своей поверхности, в отличие от других энтероцитов, которые помогают им собирать частицы из просвета и направлять их в лимфоидные ткани на своей базолатеральной стороне. Благодаря этой природе эти клетки стали центральным звеном в разработке оральных вакцин. [41] Однако они также являются одними из наиболее используемых типов клеток в просвете некоторых патогенов (например,грамм. Salmonella typhimurium, Yersinia spp, адгезивно-инвазивный Escherichia coli, реовирусов) для облегчения их инвазии. [42–44] Недавно появились сообщения о «ворсинчатых» М-клетках, которые присутствуют на ворсинчатом эпителии тонкой кишки и имеют общие функциональные и структурные характеристики с нормальными М-клетками, но лишены какой-либо лимфоидной ассоциации. [45]

    Клетки Панета

    Еще одним важным компонентом MIS являются «клетки Панета», названные в честь Джозефа Панета.Эти столбчатые клетки имеют выступающие гранулы и располагаются в основании крипт Либеркюн в тонкой кишке. Каждая крипта содержит примерно 15 стволовых клеток и 10 клеток Панета. Иногда клетки Панета также присутствуют в желудке и толстой кишке в качестве метапластической реакции на воспаление кишечника. В отличие от IECs, продолжительность жизни которых составляет 3-5 дней, клетки Панета живут относительно дольше (> 30 дней). Эти клетки имеют большие апикальные секреторные гранулы, богатые дефенсином, которые высвобождаются в узкие эпителиальные крипты посредством экзоцитоза (т.е.е. мерокринная секреция) в ответ на различные стимулы, которые включают продукты бактерий, но не продукты грибов или простейших. Клетки Панета человека экспрессируют два альфа-дефенсина: дефенсин 5 человека (HD5) и дефенсин 6 человека (HD6). [46] Они также секретируют лизоцим, секреторную фосфолипазу A2 и регенерирующий островковый белок III-альфа (RegIIIA). [47] Однако, в отличие от людей, мыши и крысы экспрессируют более двух альфа-дефенсинов. Клетки Панета мыши также секретируют многочисленные пептиды, связанные с криптдином, и РНКазу, ангиогенин 4 (для получения дополнительной информации см.[ 47 ]). Дефенсины синтезируются в виде препропептидов, которые в конечном итоге процессируются трипсином клеток Панета у людей и матриксной металлопротеиназой-7 (MMP-7) у мышей. [48] Данные экспериментальных животных показывают, что дефенсины составляют около 15% от общей антимикробной активности кишечника как у стерильных, так и у обычных мышей [49] , а концентрация дефенсинов в криптах может достигать> 10 мг. / мл. [50]

    Кишечные макрофаги

    Макрофаги (MΦ) — одни из самых распространенных лейкоцитов в собственной субэпителиальной пластинке млекопитающих, и эта популяция, вероятно, составляет самый большой резервуар макрофагов в организме.Количество MΦ в различных участках кишечника, по-видимому, тесно связано с относительной микробиологической нагрузкой, и, таким образом, они наиболее высоки в толстом кишечнике и наименьшие — в кишечнике мышей, свободных от микробов. Учитывая, что ВЗК, как полагают, вызывается аберрантным иммунным ответом на комменсальную микробиоту, которая присутствует в больших количествах в нормальной толстой кишке, и что MΦ присутствуют там постоянно, интересно подумать, почему кишечник не находится в постоянном состоянии воспаление. [51] В многочисленных исследованиях было показано, что в отличие от MΦ из других тканей, MΦ слизистой оболочки не отвечает на лиганды TLR, секретируя провоспалительные цитокины или хемокины, такие как IL-12, IL-23, TNF-α, IL-1. , IL-6 или CXCL10 (IP-10), они также не активируют костимуляторные молекулы и не генерируют продукцию ROS и оксида азота (NO) в этих условиях. [51] Однако они синтезируют IL-10 (основной противовоспалительный цитокин) конститутивно или в ответ на лиганды TLR. [52,53] Кроме того, резидентные МФ кишечника обладают высокой фагоцитарностью и экспрессируют CD36, рецептор, который способствует фагоцитозу апоптотических клеток. [51] Они также проявляют сильную бактерицидную активность, не вызывая явного воспаления, позволяя локальному MΦ действовать как брандмауэр против любых комменсальных бактерий, которые нарушают эпителиальный барьер. Они не экспрессируют высокие уровни костимулирующих молекул, таких как CD80, CD86 или CD40, но они экспрессируют цитозольные PRR, которые имеют решающее значение для их антибактериальной активности. [54] Кроме того, резидентные МФ кишечника не только вносят вклад в гомеостаз кишечника, действуя в качестве единицы утилизации отходов для местных бактерий и мертвых клеток, но также активно регулируют целостность эпителия. В результате истощение резидентного MΦ увеличивает восприимчивость мышей к экспериментально индуцированному колиту. [55,56] Экспрессия фактора транскрипции рецептора-γ, активируемого пролифератором пероксисом (PPAR-γ), посредством MΦ слизистой оболочки является альтернативным механизмом, с помощью которого они могут предотвращать локальное воспаление за счет его способности подавлять экспрессию провоспалительных генов. [57] Таким образом, MΦ в MIS можно рассматривать как функциональную подгруппу, участвующую в нормальных физиологических процессах ремоделирования ткани и избегая иммунного ответа на комменсальные микробы.

    Накопленные данные показывают, что большинство иммунных клеток в MIS способны к конститутивной секреции IL-10. Стоит отметить, что удаление IL-10 приводит к развитию спонтанного колита. [58] Кроме того, ингибирование передачи сигналов IL-10 в миелоидных клетках посредством целенаправленной делеции преобразователя сигнала и активатора транскрипции 3 (STAT3) приводит к спонтанному колиту. [59] Очевидно, что IL-10 является критическим физиологическим медиатором инерции МФ кишечника. Важный вопрос, который еще не решен, заключается в том, отражает ли измененное поведение MΦ, которое происходит во время воспаления, изменения в обычно инертном резидентном MΦ или является результатом проникновения нового, высокочувствительного профессионального MΦ. Существующие данные подтверждают последнюю идею, но неясно, принадлежат ли эти недавно прибывшие MΦ к отдельной линии от резидентного MΦ. Несколько линий доказательств указывают на то, что воспалительные MΦ происходят из недавно набранной популяции, которая происходит из циркулирующих моноцитов Ly6C hi .

    Кишечные Т-лимфоциты

    Т-клетки являются одними из наиболее распространенных лейкоцитов в субэпителиальной пластинке и играют важную роль в иммунитете кишечника млекопитающих, что подчеркивается драматическими последствиями их отсутствия, такими как инфекция вируса иммунодефицита человека (ВИЧ). Свободная от зародышей мышиная пластинка лишена Т-клеток, только первичные фолликулы в пятнах Пейера. [60,61] После колонизации бактериями популяция Т-клеток слизистой оболочки быстро увеличивается до нормального уровня, как у обычных мышей, демонстрируя, что микробные антигены или продукты необходимы для поддержания популяции Т-клеток.В целом, популяция Т-клеток у здоровых животных в основном состоит из Т-хелперных клеток 1 типа (Th2) и Т-хелперов 2 типа (Th3). В то время как болезнь Крона связана с профилем цитокинов Th2, язвенный колит имеет тенденцию к Th3. [62] Эта концепция была дополнительно усложнена описанием толеризующих регуляторных Т-клеток (Tregs) и провоспалительных клеток Th27, новой популяции Т-клеток, характеризующейся основным фактором транскрипции, связанным с RAR, орфанным рецептором гамма (ROPγt). и поверхностные маркеры IL23R и CC-хемокиновый рецептор типа 6 (CCR6). [62] Клетки Th27 дифференцируются под влиянием IL1β, IL6, IL21, IL23 и трансформирующего фактора роста бета (TGF) -β. [63–65] Клетки Th27, как известно, секретируют провоспалительные цитокины IL17A, IL17F, IL21, IL22 и IL26, а также хемокин CCL20, и несколько исследований продемонстрировали важную роль клеток Th27 в воспалении кишечника, особенно при болезни Крона. [62] Клетки Th27 играют центральную роль в нейтрализации патогенов и комменсальной микробиоты как за счет координации притока нейтрофилов, так и за счет поддержания или восстановления целостности эпителиального барьера посредством синтеза IL17 и IL22.Интересно, что эпителий слизистой оболочки экспрессирует рецепторы для этих цитокинов Th27, способствуя образованию плотных контактов, продукции антимикробных пептидов, а также выработке слизи.

    Кишечные ДК

    ДК являются наиболее мощными профессиональными антигенпрезентирующими клетками (АПК). В отличие от макрофагов, ДК могут инициировать первичный иммунный ответ, активируя наивные Т-клетки, и регулировать провоспалительные или толерогенные иммунные ответы. [66] Кроме того, DC также экспрессируют PRR для определения микробных продуктов в зависимости от окружающей среды.ДК очень гибкие и способны поляризовать иммунные ответы Th2, Th3 или Treg в зависимости от их предшествующего воздействия цитокинов / микробных лигандов. Как только DCs мигрируют в подслизистую оболочку, они становятся высокоэффективными при взятии проб содержимого кишечника через дендриты для захвата и обработки антигена [66] , происходящего через эпителиальный монослой или М-клетки. [67,68] В физиологических условиях DC играют регулирующую роль и предотвращают иммунные ответы против пищевых антигенов и микробиоты кишечника. [66] Они достигают регуляторного профиля с помощью различных сигналов [стромальный лимфопоэтин тимуса (TSLP), IL-10, TGF-β], в частности ретиноевой кислотой (RA), активной формой витамина A. В присутствии RA, кишечные DC (но не DC в других тканях) приобретают способность генерировать Treg и IgA-секретирующие B-клетки с использованием ферментов, которые превращают витамин A в RA. [69] Кишечные ДК можно отличить от ДК других тканей по (i) пониженной экспрессии PRR, (ii) пониженной экспрессии костимулирующих молекул и, таким образом, пониженной презентации антигена, (iii) более высокой продукции противовоспалительных цитокины (IL-10), (iv) способствующие дифференцировке антиген-специфических Treg и секреторных B-клеток IgA, и (v) индукция иммунной толерантности посредством экспрессии маркеров хоминга в кишечнике как в Treg, так и в IgA-секретирующих B-клетках.Любые изменения перечисленных выше характерных особенностей кишечных ДК приводят к аберрантному иммунному ответу на микробиоту, что, возможно, приводит к ВЗК.

    Врожденные лимфоидные клетки

    Врожденные лимфоидные клетки (ILC) — это недавно обнаруженные клетки врожденного иммунитета в MIS [70,71] , которые определяются отсутствием специфических рецепторов антигена и играют центральную роль в регуляции целостность барьера эпителиальных клеток кишечника, а также иммунитет, воспаление и восстановление тканей в кишечнике. [72] Истощение ILC с использованием модели мышей, не страдающих ожирением, гена-1, активирующего диабетическую рекомбинацию (NOD-Rag1 null), у мышей с двойным дефицитом общей гамма-цепи рецептора IL-2 [71] приводит к периферическому распространению комменсального бактерии и системное воспаление, которое было устранено введением IL-22, что позволяет предположить, что IL-22, продуцируемый этими клетками, играет ключевую роль в поддержании барьерной функции. [73]

    Секреторный IgA

    Самым распространенным адаптивным иммунным фактором в просвете кишечника является sIgA, который играет важную роль в гомеостазе кишечника.Он в основном секретируется в виде димера и ковалентно связан с секреторным компонентом эпителиального гликопротеина. Субэпителиальные B-клетки в кишечнике секретируют IgA, который перемещается через монослой эпителия и чья последующая секреция в просвет кишечника представляет собой главный иммунологический барьер. [74] Основные функции sIgA включают (i) защиту от энтеропатогенов (например, Salmonella, ротавирус), (ii) обеспечение коллективного иммунитета против горизонтального фекально-орального распространения энтеропатогенов и (iii) ограничение распространения кишечных инфекций. -производные антигены в кровоток (см. [75] для подробностей). Люминальный sIgA играет важную роль в защите от Vibrio cholera и энтеротоксигенной E. coli. Кроме того, микробиота хозяина играет ключевую роль в секреции IgA, поскольку давно известно, что мыши-гнотобиоты обнаруживают поразительно пониженные уровни sIgA в фекалиях.

    IEC, которые находятся в непосредственной близости с микробиотой, играют роль в процессе секреции IgA. Лучшим примером является то, что развитие ILF из криптопатчей зависит от восприятия микробиоты нуклеотид-связывающим белком 1 домена олигомеризации (NOD1), что приводит к секреции хемоаттрактанта B-клеток CCL20 посредством IEC.ILF являются преобладающими сайтами продукции sIgA независимо от Т-клеток. Воспаление кишечника значительно увеличивает секрецию sIgA в просвет. Например, у мышей, экспрессирующих конститутивно активную форму TLR-4, отсутствовал спонтанный колит, но наблюдалось увеличение рекрутирования В-клеток и продукции трофических факторов, что приводило к увеличению продукции sIgA. [76] Было показано, что в дополнение к влиянию на рекрутирование B-клеток, IECs конститутивно продуцируют факторы, которые напрямую стимулируют продукцию IgA посредством продукции IL-6, и индуцируют B-клеточный IgA 2 переключение классов посредством стимуляции пролиферации -индуцирующий лиганд (APRIL).Передача сигналов врожденного иммунитета через TLR также увеличивает транзит sIgA в просвет, поскольку воздействие на IECs LPS или инактивированных нагреванием E. coli приводит к повышенной экспрессии полимерного рецептора Ig, который связывается с субэпителиальным IgA и перемещает его через эпителий. . Несмотря на то, что несколько исследований показывают, что ДК, взявшие образцы просветных антигенов, являются движущей силой секреции sIgA, эпителий, подвергшийся воздействию микробов, также может влиять на этот процесс, что еще больше подчеркивает важность IEC в MIS.Tregs также играют роль в индукции sIgA, и индукция Treg совпадает с мощной индукцией sIgA [77] при колонизации микробиоты. И люди, и мыши, у которых выборочно отсутствует IgA, проявляют слабые симптомы, поскольку IgM может компенсировать дефицит IgA. [78,79]

    Микробиота способствует развитию хозяина MIS

    Кишечник млекопитающих населен большим разнообразным сообществом микробов, которые вместе известны как кишечная микробиота; он содержит примерно 10 14 бактерий массой 1-2 кг и включает 6-10 основных типов и около 3000 видов. [80] Считается, что состав микробиоты остается стабильным на протяжении всей жизни хозяина, даже при резких изменениях в диете и уровне физической активности, во время беременности и при использовании антибиотиков широкого спектра действия. [81,82]

    Интересно, что «стерильные» (также называемые гнотобиотиками) мыши, лишенные микробиоты, имеют значительные иммунные и метаболические дефекты. [83] Однако накопленные данные на различных моделях мышей с иммунодефицитом показывают, что измененная микробиота играет центральную роль в возникновении воспаления кишечника и метаболических заболеваний. [84] Вместе эти исследования предполагают, что гомеостаз микробиоты необходим для поддержания благоприятных симбиотических отношений.

    С этой целью MIS разработала несколько способов поддержания гомеостаза микробиоты и хозяина и защиты от патогенов. PRR врожденной иммунной системы, особенно TLR и NOD-подобные рецепторы (NLR), играют важную роль в этих процессах. И TLR, и NLR распознают множество широко консервативных микробных компонентов.

    Распознавание образов в кишечнике

    Учитывая потенциально подавляющую микробную биомассу в кишечнике и тот факт, что несколько PRR могут ощущать свои родственные агонисты на пикомолярных уровнях, хозяин разработал ряд эффективных механизмов для предотвращения постоянной / повторяющейся активации PRR, в то время как поддержание способности активировать PRR, когда это необходимо, чтобы максимизировать преимущества, предоставляемые микробиотической стабильностью [и].

    Таблица 1

    Лиганды рецепторов распознавания образов

    Рецептор Микробный продукт Ссылки
    TLR-1 (с TLR-2) липопротеины липопротеины Микобактерии липопротеины и др. , 2002
    Shimizu, Kida et al. , 2007
    TLR-2 (с TLR-1 или TLR-6) грамположительные бактерии
    Пептидогликан, липотейхоевая кислота
    Зимозан, липарабиноманнан
    Бактериальные гликолипиды, дрожжевой краузин 43 GPI
    354 ЛПС из Leptospira interrogans
    ЛПС из Porphyromonas gingivalis (более цилиндрический)
    Aliprantis, Yang et al., 1999; Schwandner, Dziarski et al. , 1999; Такеучи, Хосино и др. , 1999; Хаджар, О’Махони и др. , 2001; Opitz, Schroder et al. , 2001; Werts, Tapping et al. , 2001; Коэльо, Кляйн и др. , 2002; Massari, Henneke et al. , 2002
    TLR-3 Вирусная дцРНК, синтетическая полиинозиновая кислота: цитидиловая кислота (поли I: C) Alexopoulou, Holt et al. , 2001
    TLR-4 Грамотрицательные бактерии
    ЛПС (коническая форма), пневмолизин
    Липид А (строго цилиндрический, антагонист)
    ЛПС из Rhodobacter sphaeroides (строго цилиндрический)
    Flavolipium mens.
    Респираторно-синцитиальный вирусный белок F
    Aspergillus fumigatus hyphae
    HSP 60 и 70, гиалуронан
    Домен фибронектина A, фибриноген
    Некротические клетки, насыщенные жирные кислоты, таксол (только у мышей)
    Poltora35., 1998; Кавасаки, Акаши и др. , 2000; Курт-Джонс, Попова и др. , 2000; Охаши, Буркарт и др. , 2000; Берд-Лейфер, Блок и др. , 2001; Окамура, Ватари и др. , 2001; Смайли, Кинг и др. , 2001; Bulut, Faure et al. , 2002; Джонсон, Брун и др. , 2002; Расса, Мейерс и др. , 2002; Termeer, Benedix et al. , 2002; Vabulas, Ahmad-Nejad et al. , 2002; Хуанг, Рутковски и др., 2012
    TLR-5 Флагеллин Hayashi, Smith et al. , 2001
    TLR-6 (с TLR-2) Липопротеины микоплазмы, липотейхоевая кислота, пептидогликан Schwandner, Dziarski et al. , 1999; Морр, Такеучи и др. , 2002
    TLR-7 и TLR-8 Одноцепочечная РНК, имидазохиналоны Diebold, Kaisho et al. , 2004; Heil, Hemmi et al., 2004
    TLR-9 CpG ДНК, гемозоин Hemmi, Takeuchi et al. , 2000
    TLR-10 Неизвестно
    TLR-11 Уропатогенные бактерии
    Профилин-подобная молекула белка в Toxoplasma gondii Zhang 5, Zhang et al. , 2004; Кобланский, Янкович и др. , 2013
    TLR-12 Профилин-подобная молекула белка в Toxoplasma gondii Koblansky, Jankovic et al., 2013
    RIG-1 5′-трифосфорилированная дцРНК Yoneyama, Kikuchi et al. , 2004
    MDA-5 Длинная дцРНК Kato, Takeuchi et al. , 2008
    Протеинкиназа R dsRNA Williams 2001
    Dectin-I β-глюканы Brown, Taylor et al. , 2002
    Рецептор маннозы Липарабиноманнан Schlesinger, Hull et al., 1994
    рецептор f-MLP f-MLP Boulay, Tardif et al. , 1990
    Moesin LPS Amar, Oyaisu et al. , 2001; Иончева, Амар и др. , 2004

    Таблица 2

    Нуклеотидсвязывающие и олигомеризационные домеподобные рецепторы

    Семейство Рецептор Лиганды Ссылки ??
    NLRB NAIPs Флагеллин, палочковидные белки Kofoed and Vance 2011
    NLRC NOD-1 γ-d-iED-Dluso-DAP (9ED-Dluso) , мезо -DAP, d-лактил-l-ala-γ-Glu- мезо -DAP-Gly (FK156), гептанолил-γ-Glu- мезо -DAP-d-ala (FK565) Chamaillard, Hashimoto et al., 2003; Girardin, Travassos et al. , 2003; Wilmanski, Petnicki-Ocwieja et al. , 2008
    NOD-2 Мурамилдипептид (MDP), MurNAc-l-Ala-γ-d-Glu-l-Lys (M-TRILys) Girardin, Boneca et al. , 2003; Girardin, Travassos et al. , 2003
    NLRC3 / C5 / X1 ??
    NLRC4 Флагеллин, система секреции бактерий 3-го типа (T3SS) Lightfield, Persson et al., 2008; Мяо, Мао и др. , 2010
    NLRP NLRP1 Бактериальные токсины, MDP, пониженный уровень цитозольного АТФ (?) Boyden and Dietrich 2006; Faustin, Lartigue et al. , 2007; Frew, Joag et al. , 2012; Левинсон, Ньюман и др. , 2012; Liao and Mogridge 2013
    NLRP3 Токсины, бактериальная и вирусная РНК, oxMito-ДНК, церамид, кардиолипин, отток K +, митохондриальные / лизосомные нарушения, ROS, кристаллы / агрегаты, передача сигналов Ca ++, Ex-ATP, кристаллы кремнезема и соли алюминия Hornung, Bauernfeind et al., 2008; Tschopp and Schroder 2010; Leemans, Cassel et al. , 2011
    NLRP6 Бактериальные продукты (?) Ананд, Малиредди и др. , 2012; Anand and Kanneganti 2013
    NLRP7 Бактериальные ацилированные липопептиды (acLP) Khare, Dorfleutner et al. , 2012
    NLRP10 ??
    NLRP11 ??
    NLRP12 Ацилированный липид A Lupfer and Kanneganti 2013
    NLRX NLRX1 Poly I: C 35, 2012

    Помимо физических препятствий для активации PRR обильными микробными лигандами просвета [и], а именно вышеупомянутым толстым слоем слизи, насыщенным антибактериальными соединениями, существуют дополнительные механизмы для ингибирования аберрантной активации PRR в кишечнике. Одним из таких механизмов является избирательность кишечника в отношении типов клеток и условий, в которых экспрессируются TLR. Например, TLR 2 и 4, рецепторы для компонентов стенки бактериальной клетки, пептидогликана и LPS, соответственно, почти не экспрессируются в здоровых IEC, но активируются в условиях, связанных с IBD. [85] Кроме того, активация TLR-4, наиболее провоспалительного из PRR, в IEC также предотвращается за счет ограничения доступности корецепторов, фактора миелоидной дифференцировки 2 (MD-2), CD14 и LPS- связывающий белок. [86] TLR 2 и 4 также экспрессируются на более высоких уровнях с помощью IECs, которые еще не мигрировали вверх по ворсинкам, гарантируя, что надежная активация этих PRR происходит только в том случае, если крипта, которая обычно не колонизируется, находится под угрозой. [87] Кроме того, рецептор флагеллина, TLR-5, экспрессируется только на базолатеральной стороне IECs, стратегия, которая позволяет хозяину генерировать ответ только на инвазивные жгутиковые микробы. [88] TLR-9 уникален среди TLR в том смысле, что он способен подавлять передачу сигналов через все TLR. В то время как базолатеральная активация TLR-9 микробиотной ДНК вызывает классический ядерный фактор, усиливающий каппа-легкую цепь активированных В-клеток (NF-κB), опосредованный воспалительным ответом, апикальный TLR-9 ослабляет такой ответ через альтернативный путь передачи сигналов, который притупляет Активность ИЛ-8, ингибирующая хемотаксис нейтрофилов. [89,90] Кроме того, постоянное воздействие их соответствующих лигандов может привести к иммунологической толерантности, механизму, который также может защитить от аберрантного воспаления и даже аутоиммунитета. [91] Таким образом, врожденный иммунный ответ в кишечнике можно рассматривать как предотвращение чрезмерной активации PRR, которая могла бы возникнуть, если микробиота не управлялась должным образом. Такой жесткий контроль за взаимодействиями микробиоты и PRR служит для ограничения аберрантного воспаления.

    Сходным образом нуклеотидсвязывающие и олигомеризационные домены (NOD) -подобные рецепторы (NLR) эволюционировали в IEC, чтобы избежать сверхактивных воспалительных реакций на резидентную микробиоту, а также для сохранения целостности и функций эпителиального барьера путем поддержания гомеостаза.Недавние исследования кишечной микробиоты в контексте дефицита NLR показывают, что врожденные изменения плотности или численности бактерий могут лежать в основе развития воспалительных заболеваний. Инфламмасомы стали центральными регуляторами кишечной инфекции, иммунитета и воспаления. В дополнение к опосредованию целостности кишечного эпителия, антимикробным ответам и инициированию воспаления посредством генерации цитокинов IL-1β и IL-18, инфламмасома, по-видимому, играет ключевую роль в контроле состава кишечной микробиоты. [92] Мыши с дефицитом инфламмасомы демонстрируют аберрантное микробное сообщество, которое преимущественно передается здоровым мышам, что приводит к передаче неалкогольной жировой болезни печени (НАЖБП), ожирению, воспалению кишечника и раку. [93,94]

    Факторы транскрипции в кишечном иммунитете

    Сигнальный путь NF-κB в эпителии кишечника имеет решающее значение не только для секреции множества хемоаттрактантов, но также для индукции противомикробных и провоспалительных ферментов, таким образом, играет ключевую роль в эпителиальном гомеостазе.Соответственно, IEC-специфическое ингибирование NF-κB посредством условного удаления эссенциального модулятора NF-κB (NEMO) (IκB-киназа-гамма, необходимого для активации NF-κB) вызывает спонтанное хроническое воспаление кишечника у мышей. [95] Дефицит NF-κB привел к апоптозу эпителиальных клеток толстой кишки, сопровождающемуся нарушением экспрессии антимикробных пептидов и транслокацией бактерий в слизистую оболочку. [95] Одновременно этот эпителиальный дефект вызвал хронический воспалительный ответ в толстой кишке, в котором сначала преобладали клетки врожденного иммунитета, но позже вовлекались и Т-лимфоциты.Важно отметить, что дефицит гена, кодирующего адаптерный белок MyD88, предотвращает развитие воспаления кишечника, демонстрируя, что активация TLR кишечными бактериями важна для патогенеза заболевания. [95] Однако, даже если активация TLR кишечными бактериями важна для патогенеза заболевания, передачу сигналов TLR следует рассматривать скорее как полезный путь, который также может стать вредным в ситуации иммунодефицита, такой как делеция NEMO. Более того, активация TLR микробиотой имеет решающее значение для защиты от повреждения кишечника и связанной с этим смертности, выявляя защитную функцию TLR при взаимодействии между хозяином и микробом. [96,97] Помимо NF-κB, несколько других факторов транскрипции, таких как T-bet и семейство STAT, также играют роль в гомеостазе кишечника. [98–101]

    Бактериальные метаболиты в развитии MIS

    Известно, что микробиота играет ключевую роль в развитии собственной лимфоидной системы кишечника и гомеостаза кишечника. Однако механизм, с помощью которого сигналы и метаболиты микробиоты управляют гомеостазом кишечника, был в значительной степени неизвестен. В недавнем исследовании Smith et al. обнаружил, что короткоцепочечные жирные кислоты (SCFA), такие как ацетат, бутират и пропионат, образующиеся в результате бактериальной ферментации пищевых волокон, играют ключевую роль в расширении Treg-клеток кишечной, но не внекишечной лимфоидной ткани. [102] SCFAs специфически увеличивают количество как у гнотобиотических, так и у обычных мышей. Кроме того, с помощью экспериментов по совместному культивированию было обнаружено, что SCFAs улучшают ингибирующую активность Treg в отношении CD4 +. [102] В модели хронического колита с адоптивным переносом Т-клеток мыши, предварительно обработанные только пропионатом или смесью SCFA, были существенно защищены по сравнению с контрольными мышами.В аналогичной строке Arpaia et al. обнаружил, что бутират, продуцируемый микробиотой, способствует экстратимической генерации Treg-клеток. [103] Кроме того, пропионат усиливал de novo генерацию Treg на периферии. Эти исследования демонстрируют, что не только ассоциированные с бактериями лиганды могут участвовать в правильном развитии MIS хозяина, но также их метаболиты могут глубоко влиять на генерацию ключевых популяций регуляторных клеток адаптивной иммунной системы.

    Кишечный иммунитет к небактериальным организмам

    Иммунная система кишечника способна вызывать иммунные ответы не только на бактерии, но и на множество простейших паразитов, таких как Toxoplasma, Entoamoeba, и Giardia, , количество которых растет. создает серьезную проблему, особенно у хозяев с ослабленным иммунитетом. [104] В то время как восприимчивость к хронической инфекции передается за счет цитокиновых ответов Th2 (характеризующихся продуцированием IL-12, IL-18 и IFN-γ), иммунитет к взрослым нематодным червям, обитающим в кишечнике, критически зависит от Th3 цитокиновый ответ (контролируемый цитокинами IL-4, IL-5, IL-9 и IL-13).Недавно было показано, что заражение мышей Toxoplasma gondii приводит к дисбактериозу микробиоты, [105] , характеризующемуся временным обогащением Enterobacteriaceae, принадлежащими Proteobacteria. Ключевое наблюдение в этом исследовании заключается в том, что мышей, инфицированных T. gondii , демонстрировали потерю клеток Панета в тонком кишечнике из-за повреждения митохондрий, которое зависело от микробиоты, передачи сигналов TLR-11, IFN-γ и MyD88 в CD4 + Т-клетках. . [105] Интересно, что т.gondii -индуцированный дисбиоз микробиоты в некоторой степени похож на микробиотические изменения, наблюдаемые на животных моделях воспаления кишечника и при ВЗК человека, подчеркивая условно-патогенную активность семейства Enterobacteriaceae, в частности E. coli . В совокупности это исследование демонстрирует, что TLR не только помогают сохранить микробиотический гомеостаз, но также влияют на дисбактериоз, повреждая клетки-хозяева, которые обычно секретируют антимикробные пептиды.

    Диета и иммунитет кишечника

    В настоящее время многочисленные исследования показали, что диета прямо или косвенно играет важную роль в раннем развитии иммунной системы кишечника.В частности, помимо основных макроэлементов, большое влияние на MIS могут оказывать такие микроэлементы, как витамины A и D, и минералы, такие как железо. Недавнее добавление к списку все более заметных диетических компонентов — это химические вещества, присутствующие в овощах, в частности, из семейства Brassicaceae, а также лактоза в молоке. Некоторые диетические факторы также способствуют патогенезу заболевания, в том числе молочный жир, действующий как колитогенный фактор у восприимчивых мышей, способствуя росту конкретной бактерии, Bilophila wadsworthia . [106]

    Давно известно, что богатые глютеном белки (пшеница, рожь) являются движущими факторами в этиологии целиакии (БК). Хотя вклад адаптивного иммунитета в патогенез CD хорошо известен, доказательства прямого участия врожденного иммунитета, который необходим для установления связи адаптивного иммунитета, отсутствуют. Недавнее исследование устраняет этот пробел, демонстрируя, что молекулы устойчивости к вредителям [ингибиторы α-амилазы / трипсина (ATI) CM3 и 0,19] в пшенице действуют как сильные активаторы моноцитов, макрофагов и DC через TLR-4 – MD2 – CD14, таким образом, инициирование иммунного ответа, который приводит к активации адаптивного иммунитета (Т-лимфоцитов), который управляет патогенезом CD. [107]

    Заключение

    В заключение, кишечную иммунную систему млекопитающих следует рассматривать как сложное взаимодействие между физическими, химическими и клеточными барьерами, обширным сообществом бактерий и множеством иммунных клеток хозяина, которые опосредуют врожденные и адаптивный иммунитет. Кишечная микробиота помогает в правильном развитии иммунной системы хозяина, которая, в свою очередь, регулирует гомеостаз микробиоты. [108] Накопление доказательств за последнее десятилетие показывает, что взаимодействие MIS и микробиоты должно быть точно сбалансировано, и любые нарушения этого взаимодействия могут привести к микробиотическому и иммунному дисбиозу, ведущему к воспалительным нарушениям.Быстрый всплеск возникающих заболеваний нового поколения, таких как ВЗК, ревматоидный артрит, сердечно-сосудистые заболевания и метаболический синдром, побудил исследователей изучить их этиологию во многих направлениях, таких как генетика, диета и факторы окружающей среды, а также взаимодействия MIS и микробиоты. . Кроме того, соблюдение строгих гигиенических и санитарных условий и потребление продуктов с высокой степенью обработки, содержащих большое количество жиров, углеводов и клетчатки, с многочисленными пищевыми добавками и консервантами, может быть причиной изменения микробного состава, метаболизма и взаимодействия с иммунитетом хозяина.Почти все вышеперечисленные заболевания характеризуются как местным, так и системным хроническим или субклиническим воспалением слабой степени, при котором воспаление возникает в кишечнике в результате взаимодействия между MIS хозяина и микробиотой. Гиппократ (460–370 гг. До н.э.) утверждал: «Все болезни начинаются в кишечнике».

    Ссылки

    1. Оресик М., Сеппанен-Лааксо Т., Йетукури Л., Бэкхед Ф., Ханнинен В. Микробиота кишечника влияет на липидный состав хрусталика и сетчатки. Exp Eye Res. 2009; 89: 604–7. [PubMed] [Google Scholar] 2.Hamer HM, Jonkers D, Venema K, Vanhoutvin S, Troost FJ, Brummer RJ. Обзорная статья: роль бутирата в функции толстой кишки. Алимент Pharmacol Ther. 2008; 27: 104–19. [PubMed] [Google Scholar] 3. Кейн М., Кейс Л.К., Копаски К., Козлова А., МакДирмид С., Червонский А.В. и др. Успешная передача ретровируса зависит от комменсальной микробиоты. Наука. 2011; 334: 245–9. [Бесплатная статья PMC] [PubMed] [Google Scholar] 4. Kuss SK, Best GT, Etheredge CA, Pruijssers AJ, Fierson JM, Hooper LV и др. Кишечная микробиота способствует репликации кишечного вируса и системному патогенезу.Наука. 2011; 334: 249–52. [Бесплатная статья PMC] [PubMed] [Google Scholar] 7. Slack E, Hapfelmeier S, Stecher B, Velykoredko Y, Stoel M, Lawson MA и др. Врожденный и адаптивный иммунитет гибко взаимодействуют, чтобы поддерживать мутуализм хозяина и микробиоты. Наука. 2009; 325: 617–20. [Бесплатная статья PMC] [PubMed] [Google Scholar] 8. Hoshi H, Aijima H, Horie K, Nagata H, Kaneko T., Ikeda T. Лимфатические фолликулы и зародышевые центры в подколенных лимфатических узлах и других лимфоидных тканях стерильных и обычных крыс. Tohoku J Exp Med.1992; 166: 297–307. [PubMed] [Google Scholar] 9. Тернер-младший. Барьерная функция слизистой оболочки кишечника при здоровье и болезни. Nat Rev Immunol. 2009; 9: 799–809. [PubMed] [Google Scholar] 10. Йоханссон М.Э., Филлипсон М., Петерссон Дж., Вельчич А., Холм Л., Ханссон Г.С. Внутренний из двух слоев слизи, зависимой от муцина Muc2 в толстой кишке, лишен бактерий. Proc Natl Acad Sci USA. 2008; 105: 15064–9. [Бесплатная статья PMC] [PubMed] [Google Scholar] 13. Hasnain SZ, Gallagher AL, Grencis RK, Thornton DJ. Новая роль муцинов в иммунитете: данные о желудочно-кишечной нематодной инфекции.Int J Biochem Cell Biol. 2013; 45: 364–74. [PubMed] [Google Scholar] 14. Шекельс Л.Л., Анвей Р.Э., Лин Дж., Кеннеди М.В., Гарсайд П., Лоуренс К.Э. и др. Скоординированная экспрессия гена муцина Muc2 и Muc3 при инфекции Trichinella spiralis у мышей дикого типа и мышей с дефицитом цитокинов. Dig Dis Sci. 2001; 46: 1757–64. [PubMed] [Google Scholar] 15. Пиллаи К., Пургхолами М.Х., Чуа Т.К., Моррис Д.Л. MUC1 как потенциальная мишень в противоопухолевой терапии. Am J Clin Oncol. DOI 2013: 10.1097 / COC.0b013e31828f5a07. [PubMed] [CrossRef] [Google Scholar] 16.Ван дер Слуис М., Де Конинг Б.А., Де Брюйн А.С., Вельчич А., Мейеринк Дж. П., Ван Гудувер Дж. Б. и др. У мышей с дефицитом Muc2 спонтанно развивается колит, что указывает на то, что MUC2 имеет решающее значение для защиты толстой кишки. Гастроэнтерология. 2006; 131: 117–29. [PubMed] [Google Scholar] 17. McDole JR, Wheeler LW, McDonald KG, Wang B, Konjufca V, Knoop KA и др. Бокаловидные клетки доставляют люминальный антиген к дендритным клеткам CD103 + в тонком кишечнике. Природа. 2012; 483: 345–9. [Бесплатная статья PMC] [PubMed] [Google Scholar] 18. Вэй X, Ян З., Рей Ф. Е., Ридаура В. К., Дэвидсон Н. О., Гордон Дж. И. и др.Синтаза жирных кислот модулирует функцию кишечного барьера посредством пальмитоилирования муцина 2. Клеточный микроб-хозяин. 2012; 11: 140–52. [Бесплатная статья PMC] [PubMed] [Google Scholar] 19. Вареди М., Грили Г. Х., младший, Херндон Д. Н., Англичанин Е. В.. Циркулирующий фактор (ы), вызванный термическим повреждением, ставит под угрозу морфологию, пролиферацию и миграцию кишечных клеток. Am J Physiol. 1999; 277: G175–82. [PubMed] [Google Scholar] 20. Гордон Дж. И., Шмидт Г. Х., Рот К. А.. Исследования стволовых клеток кишечника на нормальных, химерных и трансгенных мышах.FASEB J. 1992; 6: 3039–50. [PubMed] [Google Scholar] 21. Митич Л.Л., Андерсон Дж. М.. Молекулярная архитектура плотных контактов. Annu Rev Physiol. 1998. 60: 121–42. [PubMed] [Google Scholar] 22. Брант С.Р., Панхуисен К.И., Николае Д., Редди Д.М., Бонен Д.К., Каралюкас Р. и др. Полиморфизм MDR1 Ala893 связан с воспалительным заболеванием кишечника. Am J Hum Genet. 2003. 73: 1282–92. [Бесплатная статья PMC] [PubMed] [Google Scholar] 23. Панвала С.М., Джонс Дж. К., Вини Дж. Л.. Новая модель воспалительного заболевания кишечника: у мышей с дефицитом гена множественной лекарственной устойчивости mdr1a спонтанно развивается колит.J Immunol. 1998. 161: 5733–44. [PubMed] [Google Scholar] 25. Маккормик Б.А., Колган С.П., Дельп-Арчер С., Миллер С.И., Мадара Дж.Л. Присоединение Salmonella typhimurium к монослоям кишечного эпителия человека: трансклеточная передача сигналов субэпителиальным нейтрофилам. J Cell Biol. 1993; 123: 895–907. [Бесплатная статья PMC] [PubMed] [Google Scholar] 26. Китс С., Китс А.С., Мидзогучи Е., Бхан А., Келли С.П. Энтероциты являются основным источником хемокина ENA-78 при нормальной толстой кишке и при язвенном колите. Am J Physiol. 1997; 273: G75–82.[PubMed] [Google Scholar] 27. Двинелл МБ, Йохансен П.А., Смит Дж. М.. Иммунобиология эпителиальных хемокинов слизистой оболочки кишечника. Операция. 2003. 133: 601–7. [PubMed] [Google Scholar] 28. Гасперини С., Марчи М., Кальцетти Ф., Лауданна С., Вичентини Л., Олсен Х. и др. Экспрессия генов и продукция монокина, индуцированная IFN-гамма (MIG), IFN-индуцируемым альфа-хемоаттрактантом T-клеток (I-TAC) и IFN-гамма-индуцируемым протеином-10 (IP-10) хемокинами нейтрофилами человека. J Immunol. 1999; 162: 4928–37. [PubMed] [Google Scholar] 29.Шибахара Т., Уилкокс Дж. Н., Коус Т., Мадара Дж. Л.. Характеристика эпителиальных хемоаттрактантов для интраэпителиальных лимфоцитов кишечника человека. Гастроэнтерология. 2001; 120: 60–70. [PubMed] [Google Scholar] 30. Кромвель О., Хамид К., Корриган С.Дж., Барканс Дж., Мэн К., Коллинз П.Д. и др. Экспрессия и генерация интерлейкина-8, IL-6 и фактора, стимулирующего колонию гранулоцитов-макрофагов, бронхиальными эпителиальными клетками и усиление IL-1 бета и фактором некроза опухоли альфа. Иммунология. 1992; 77: 330–7. [Бесплатная статья PMC] [PubMed] [Google Scholar] 31.Ситараман С.В., Мерлин Д., Ван Л., Вонг М., Гевирц А.Т., Си-Тахар М. и др. Нейтрофил-эпителиальный перекрестный контакт на поверхности просвета кишечника, опосредованный реципрокной секрецией аденозина и ИЛ-6. J Clin Invest. 2001; 107: 861–9. [Бесплатная статья PMC] [PubMed] [Google Scholar] 32. Лю Й., Буринг Х. Дж., Зен К., Burst SL, Шнелл Ф. Дж., Уильямс И. Р. и др. Сигнальный регуляторный белок (SIRPalpha), клеточный лиганд для CD47, регулирует трансмиграцию нейтрофилов. J Biol Chem. 2002; 277: 10028–36. [PubMed] [Google Scholar] 33.Parkos CA, Colgan SP, Liang TW, Nusrat A, Bacarra AE, Carnes DK, et al. CD47 опосредует постадгезивные события, необходимые для миграции нейтрофилов через поляризованный эпителий кишечника. J Cell Biol. 1996; 132: 437–50. [Бесплатная статья PMC] [PubMed] [Google Scholar] 34. Colgan SP, Parkos CA, Delp C, Arnaout MA, Madara JL. Миграция нейтрофилов через культивируемые монослои кишечного эпителия модулируется воздействием на эпителий IFN-гамма сильно поляризованным образом. J Cell Biol. 1993; 120: 785–98. [Бесплатная статья PMC] [PubMed] [Google Scholar] 35.Аксентиевич И., Мастерс С.Л., Фергюсон П.Дж., Дэнси П., Френкель Дж., Ван Ройен-Керкхофф А. и др. Аутовоспалительное заболевание с дефицитом антагониста рецепторов интерлейкина-1. N Engl J Med. 2009; 360: 2426–37. [Бесплатная статья PMC] [PubMed] [Google Scholar] 36. Аренд В.П., Маляк М., Гатридж С.Дж., Габай С. Антагонист рецептора интерлейкина-1: роль в биологии. Анну Рев Иммунол. 1998. 16: 27–55. [PubMed] [Google Scholar] 37. Молнарфи Н., Хика-Носпикель Н., Груаз Л., Дайер Дж. М., Бургер Д. Производство антагониста рецептора ИЛ-1 в моноцитах человека, стимулированных ИФН-бета, зависит от активации фосфатидилинозитол-3-киназы, но не STAT1.J Immunol. 2005; 174: 2974–80. [PubMed] [Google Scholar] 38. Карвалью Ф.А., Эйткен Д.Д., Гевиртц А.Т., Виджай-Кумар М. Активация TLR5 индуцирует секреторный антагонист рецептора интерлейкина-1 (sIL-1Ra) и снижает повреждение тканей, связанное с воспалением массом. Mucosal Immunol. 2011; 4: 102–11. [Бесплатная статья PMC] [PubMed] [Google Scholar] 40. Kraehenbuhl JP, Neutra MR. Эпителиальные М-клетки: дифференциация и функция. Annu Rev Cell Dev Biol. 2000; 16: 301–32. [PubMed] [Google Scholar] 41. Джепсон М.А., Кларк М.А., Херст Б.Н. Нацеливание на М-клетки лектинами: стратегия вакцинации слизистых оболочек и доставки лекарств.Adv Drug Deliv Rev. 2004; 56: 511–25. [PubMed] [Google Scholar] 42. Пикард Ю.М., Червонский А.В. Забор кишечной микробиоты эпителиальными М-клетками. Curr Gastroenterol Rep. 2010; 12: 331–9. [PubMed] [Google Scholar] 43. Баумлер А.Дж., Цолис Р.М., Хеффрон Ф. Фимбриальный оперон lpf опосредует адгезию Salmonella typhimurium к мышиным пятнам Пейера. Proc Natl Acad Sci USA. 1996; 93: 279–83. [Бесплатная статья PMC] [PubMed] [Google Scholar] 44. Chassaing B, Rolhion N, de Vallee A, Salim SY, Prorok-Hamon M, Neut C и др.Связанные с болезнью Крона адгезивно-инвазивные бактерии E. coli нацелены на мышиные и человеческие пятна Пейера через длинные полярные фимбрии. J Clin Invest. 2011; 121: 966–75. [Бесплатная статья PMC] [PubMed] [Google Scholar] 45. Jang MH, Kweon MN, Iwatani K, Yamamoto M, Terahara K, Sasakawa C и др. М-клетки ворсинок кишечника: сайт проникновения антигена в эпителий слизистой оболочки. Proc Natl Acad Sci USA. 2004. 101: 6110–5. [Бесплатная статья PMC] [PubMed] [Google Scholar] 47. Clevers HC, Bevins CL. Клетки Панета: Маэстро крипт тонкого кишечника.Annu Rev Physiol. 2013; 75: 289–311. [PubMed] [Google Scholar] 48. Гош Д., Портер Э., Шен Б., Ли С.К., Уилк Д., Дразба Дж. И др. Трипсин клеток Панета является процессирующим ферментом дефенсина-5 человека. Nat Immunol. 2002; 3: 583–90. [PubMed] [Google Scholar] 49. Пуцеп К., Аксельссон Л.Г., Боман А., Мидтведт Т., Нормарк С., Боман Х.Г. и др. Свободные от зародышей и колонизированные мыши производят одни и те же продукты из кишечных продефенсинов. J Biol Chem. 2000; 275: 40478–82. [PubMed] [Google Scholar] 50. Ayabe T, Satchell DP, Wilson CL, Parks WC, Selsted ME, Ouellette AJ.Секреция микробицидных альфа-дефенсинов кишечными клетками Панета в ответ на бактерии. Nat Immunol. 2000; 1: 113–8. [PubMed] [Google Scholar] 51. Смитис Л. Е., Продавцы М., Клементс Р. Х., Мостеллер-Барнум М., Менг Г., Бенджамин У. С. и др. Макрофаги кишечника человека проявляют сильную воспалительную анергию, несмотря на активную фагоцитарную и бактерицидную активность. J Clin Invest. 2005; 115: 66–75. [Бесплатная статья PMC] [PubMed] [Google Scholar] 53. Мурай М., Туровская О., Ким Дж., Мадан Р., Карп С.Л., Черутре Х. и др.Интерлейкин 10 действует на регуляторные Т-клетки, поддерживая экспрессию фактора транскрипции Foxp3 и подавляя функцию у мышей с колитом. Nat Immunol. 2009. 10: 1178–84. [Бесплатная статья PMC] [PubMed] [Google Scholar] 54. Ругтвейт Дж., Бакка А., Брандтзаег П. Дифференциальное распределение B7.1 (CD80) и B7. 2 (CD86) костимулирующие молекулы на подмножествах макрофагов слизистой оболочки при воспалительном заболевании кишечника (ВЗК) человека Clin Exp Immunol. 1997; 110: 104–13. [Бесплатная статья PMC] [PubMed] [Google Scholar] 55. Куаллс Дж. Э., Каплан А. М., ван Ройен Н., Коэн Д. А..Подавление экспериментального колита мононуклеарными фагоцитами кишечника. J Leukoc Biol. 2006; 80: 802–15. [PubMed] [Google Scholar] 56. Макдональд К.П., Палмер Дж. С., Кронау С., Сеппанен Э., Олвер С., Раффельт NC и др. Антитело против рецептора колониестимулирующего фактора 1 истощает резидентную субпопуляцию моноцитов и макрофагов, ассоциированных с тканями и опухолями, но не подавляет воспаление. Кровь. 2010; 116: 3955–63. [PubMed] [Google Scholar] 57. Hontecillas R, Horne WT, Climent M, Guri AJ, Evans C, Zhang Y и др.Иммунорегуляторные механизмы макрофагов PPAR-гамма у мышей с экспериментальным воспалительным заболеванием кишечника. Mucosal Immunol. 2011; 4: 304–13. [Бесплатная статья PMC] [PubMed] [Google Scholar] 58. Kuhn R, Lohler J, Rennick D, Rajewsky K, Muller W. У мышей с дефицитом интерлейкина-10 развивается хронический энтероколит. Клетка. 1993; 75: 263–74. [PubMed] [Google Scholar] 59. Такеда К., Клаусен Б.Е., Кайсё Т., Цудзимура Т., Терада Н., Форстер И. и др. Повышенная активность Th2 и развитие хронического энтероколита у мышей, лишенных Stat3 в макрофагах и нейтрофилах.Иммунитет. 1999; 10: 39–49. [PubMed] [Google Scholar] 60. Иванов И.И., де Фрутос Р.Л., Манель Н., Йошинага К., Рифкин Д.Б., Сартор РБ и др. Специфическая микробиота направляет дифференцировку Т-хелперных клеток, продуцирующих ИЛ-17, в слизистой оболочке тонкой кишки. Клеточный микроб-хозяин. 2008; 4: 337–49. [Бесплатная статья PMC] [PubMed] [Google Scholar] 61. Штраух У.Г., Обермайер Ф., Грюнвальд Н., Гурстер С., Дангер Н., Шульц М. и др. Влияние кишечных бактерий на индукцию регуляторных Т-клеток: уроки модели переноса колита.Кишечник. 2005; 54: 1546–52. [Бесплатная статья PMC] [PubMed] [Google Scholar] 62. Болезнь Брэнда С. Крона: Th2, Th27 или оба? Изменение парадигмы: новые иммунологические и генетические открытия указывают на то, что клетки Th27 участвуют в патогенезе болезни Крона. Кишечник. 2009. 58: 1152–67. [PubMed] [Google Scholar] 63. Aggarwal S, Ghilardi N, Xie MH, de Sauvage FJ, Gurney AL. Интерлейкин-23 способствует определенному состоянию активации CD4 Т-клеток, характеризующемуся продуцированием интерлейкина-17. J Biol Chem. 2003. 278: 1910–4. [PubMed] [Google Scholar] 64.Bettelli E, Carrier Y, Gao W., Korn T., Strom TB, Oukka M и др. Взаимные пути развития для генерации патогенных эффекторных Th27 и регуляторных Т-клеток. Природа. 2006; 441: 235–8. [PubMed] [Google Scholar] 65. Mangan PR, Harrington LE, O’Quinn DB, Helms WS, Bullard DC, Elson CO и др. Трансформирующий фактор роста бета индуцирует развитие линии T (H) 17. Природа. 2006; 441: 231–4. [PubMed] [Google Scholar] 67. Lelouard H, Fallet M, de Bovis B, Meresse S, Gorvel JP. Дендритные клетки Пейера отбирают образцы антигенов, протягивая дендриты через специфичные для М-клеток трансцеллюлярные поры.Гастроэнтерология. 2012; 142: 592–601.e3. [PubMed] [Google Scholar] 68. Rescigno M, Urbano M, Valzasina B, Francolini M, Rotta G, Bonasio R и др. Дендритные клетки экспрессируют белки с плотными контактами и проникают в монослои эпителия кишечника, чтобы взять образцы бактерий. Nat Immunol. 2001; 2: 361–7. [PubMed] [Google Scholar] 69. Coombes JL, Siddiqui KR, Arancibia-Carcamo CV, Hall J, Sun CM, Belkaid Y, et al. Функционально специализированная популяция CD103 + DC слизистой оболочки индуцирует Foxp3 + регуляторные Т-клетки посредством TGF-бета и механизма, зависимого от ретиноевой кислоты.J Exp Med. 2007. 204: 1757–64. [Бесплатная статья PMC] [PubMed] [Google Scholar] 70. Уокер Дж. А., Барлоу Дж. Л., Маккензи А. Н.. Врожденные лимфоидные клетки — как мы их пропустили? Nat Rev Immunol. 2013; 13: 75–87. [PubMed] [Google Scholar] 71. Пирсон Т., Шульц Л.Д., Миллер Д., Кинг М., Ланинг Дж., Фодор В. и др. Мыши, не страдающие ожирением, активирующие диабетическую рекомбинацию ген-1 (NOD-Rag1 null), рецептор интерлейкина (IL) -2, общая гамма-цепь (IL2r gamma null): радиорезистентная модель лимфогематопоэтического приживления человека. Clin Exp Immunol.2008. 154: 270–84. [Бесплатная статья PMC] [PubMed] [Google Scholar] 72. Tait Wojno ED, Artis D. Врожденные лимфоидные клетки: балансировка иммунитета, воспаления и восстановления тканей в кишечнике. Клеточный микроб-хозяин. 2012; 12: 445–57. [Бесплатная статья PMC] [PubMed] [Google Scholar] 73. Зонненберг Г.Ф., Монтичелли Л.А., Аленгхат Т., Фунг Т.С., Хатник Н.А., Кунисава Дж. И др. Врожденные лимфоидные клетки способствуют анатомическому сдерживанию лимфоидно-резидентных комменсальных бактерий. Наука. 2012; 336: 1321–5. [Бесплатная статья PMC] [PubMed] [Google Scholar] 74.Хупер Л.В., Макферсон А.Дж. Иммунные адаптации, поддерживающие гомеостаз кишечной микробиоты. Nat Rev Immunol. 2010. 10: 159–69. [PubMed] [Google Scholar] 75. Пабст О. Новые концепции в создании и функциях IgA. Nat Rev Immunol. 2012; 12: 821–32. [PubMed] [Google Scholar] 76. Фуката М., Шан Л., Сантаолалла Р., Сотолонго Дж., Пасторини С., Испания С. и др. Конститутивная активация эпителиального TLR4 усиливает воспалительные реакции на повреждение слизистой оболочки и приводит к онкогенезу, связанному с колитом.Воспаление кишечника. 2011; 17: 1464–73. [Бесплатная статья PMC] [PubMed] [Google Scholar] 77. Geuking MB, Cahenzli J, Lawson MA, Ng DC, Slack E, Hapfelmeier S и др. Бактериальная колонизация кишечника вызывает мутуалистические регуляторные Т-клеточные ответы. Иммунитет. 2011; 34: 794–806. [PubMed] [Google Scholar] 78. Кларк JA, Callicoat PA, Brenner NA, Bradley CA, Smith DM., Jr. Селективный дефицит IgA у доноров крови. Am J Clin Pathol. 1983; 80: 210–3. [PubMed] [Google Scholar] 79. Mbawuike IN, Pacheco S, Acuna CL, Switzer KC, Zhang Y, Harriman GR.Иммунитет слизистой оболочки к гриппу без IgA: модель мыши с нокаутом IgA. J Immunol. 1999. 162: 2530–7. [PubMed] [Google Scholar] 80. Хупер Л.В., Мидтведт Т., Гордон Дж. Как взаимодействия хозяина и микробов формируют питательную среду кишечника млекопитающих. Анну Рев Нутр. 2002; 22: 283–307. [PubMed] [Google Scholar] 81. Корен О, Спор А, Фелин Дж., Фак Ф, Стомбо Дж., Тремароли В. и др. Микробиота ротовой полости, кишечника и зубного налета человека у пациентов с атеросклерозом. Proc Natl Acad Sci USA. 2011; 108 (Приложение 1): 4592–8.[Бесплатная статья PMC] [PubMed] [Google Scholar] 82. Корен О., Гудрич Дж. К., Каллендер Т. К., Спор А, Лайтинен К., Бэкхед Х. К. и др. Ремоделирование кишечного микробиома и метаболические изменения хозяина во время беременности. Клетка. 2012; 150: 470–80. [Бесплатная статья PMC] [PubMed] [Google Scholar] 83. Wostmann BS, Larkin C, Moriarty A, Bruckner-Kardoss E. Диетическое потребление, энергетический метаболизм и экскреторные потери взрослых самцов стерильных крыс Wistar. Lab Anim Sci. 1983; 33: 46–50. [PubMed] [Google Scholar] 84. Chassaing B, Aitken JD, Gewirtz AT, Vijay-Kumar M.Микробиота кишечника вызывает метаболические заболевания у иммунологически измененных мышей. Adv Immunol. 2012; 116: 93–112. [PubMed] [Google Scholar] 85. Карвалью Ф.А., Эйткен Д.Д., Виджай-Кумар М., Гевиртц А.Т. Взаимодействие Toll-подобных рецепторов с микробиотой кишечника: беспокойство на свой страх и риск! Annu Rev Physiol. 2012; 74: 177–98. [PubMed] [Google Scholar] 86. Вамадеван А.С., Фуката М., Арнольд Е.Т., Томас Л.С., Хсу Д., Абреу М.Т. Регулирование MD-2, связанного с Toll-подобным рецептором 4, в эпителиальных клетках кишечника: всесторонний анализ. Врожденный иммунитет.2010. 16: 93–103. [Бесплатная статья PMC] [PubMed] [Google Scholar] 87. Фурри Э, Макфарлейн С, Томсон Г, Макфарлейн ГТ. Паттерны экспрессии Toll-подобных рецепторов-2, -3 и -4 в толстой кишке человека и их регуляция с помощью бактерий, связанных со слизистой оболочкой. Иммунология. 2005; 115: 565–74. [Бесплатная статья PMC] [PubMed] [Google Scholar] 88. Гевиртц А.Т., Навас Т.А., Лайонс С., Годовски П.Дж., Мадара Дж.Л. Передний край: бактериальный флагеллин активирует базолатерально экспрессируемый TLR5, чтобы вызвать экспрессию эпителиальных провоспалительных генов. J Immunol.2001; 167: 1882–5. [PubMed] [Google Scholar] 89. Гадими Д., Врезе М., Хеллер К. Дж., Шрезенмейр Дж. Влияние природной ДНК комменсального происхождения на сигнальный каскад толл-подобного рецептора 9 (TLR9), экспрессию хемокинового IL-8 и барьерную интеграцию поляризованных эпителиальных клеток кишечника. Воспаление кишечника. 2010. 16: 410–27. [PubMed] [Google Scholar] 90. Вилайсане А, Муруве Д.А. Врожденный иммунный ответ на ДНК. Semin Immunol. 2009; 21: 208–14. [PubMed] [Google Scholar] 91. Бисвас С.К., Лопес-Коллазо Э. Толерантность к эндотоксинам: новые механизмы, молекулы и клиническое значение.Trends Immunol. 2009. 30: 475–87. [PubMed] [Google Scholar] 92. Элинав Э., Тайс, Калифорния, Флавелл РА. Анализ изменений микробиоты у мышей с дефицитом инфламмасом. Методы Мол биол. 2013; 1040: 185–94. [PubMed] [Google Scholar] 93. Хенао-Мехиа Дж., Элинав Э., Джин С., Хао Л., Мехал В.З., Строиг Т. и др. Инфламмасомный дисбиоз регулирует прогрессирование НАЖБП и ожирения. Природа. 2012; 482: 179–85. [Бесплатная статья PMC] [PubMed] [Google Scholar] 95. Ненси А., Беккер С., Вулларт А., Гареус Р., ван Лоо Г., Данезе С. и др.Эпителиальный NEMO связывает врожденный иммунитет с хроническим воспалением кишечника. Природа. 2007; 446: 557–61. [PubMed] [Google Scholar] 96. Ракофф-Нахум С., Паглино Дж., Эслами-Варзане Ф., Эдберг С., Меджитов Р. Распознавание комменсальной микрофлоры толл-подобными рецепторами необходимо для гомеостаза кишечника. Клетка. 2004. 118: 229–41. [PubMed] [Google Scholar] 97. Джонс Р.М., Слоан В.М., Ву Х., Луо Л., Кумар А., Кумар М.В. и др. Введение флагеллина защищает слизистую оболочку кишечника от апоптоза, вызванного облучением, за счет активности MKP-7.Кишечник. 2011; 60: 648–57. [PubMed] [Google Scholar] 98. Пауэлл Н., Уокер А. В., Столарчик Е., Канаван Дж. Б., Гокмен М. Р., Маркс Е. и др. Фактор транскрипции T-bet регулирует воспаление кишечника, опосредованное рецептором интерлейкина-7 + врожденными лимфоидными клетками. Иммунитет. 2012; 37: 674–84. [Бесплатная статья PMC] [PubMed] [Google Scholar] 99. Гарретт WS, лорд GM, Punit S, Lugo-Villarino G, Mazmanian SK, Ito S, et al. Инфекционный язвенный колит, вызванный дефицитом T-bet во врожденной иммунной системе. Клетка. 2007; 131: 33–45.[Бесплатная статья PMC] [PubMed] [Google Scholar] 100. Neufert C, Pickert G, Zheng Y, Wittkopf N, Warntjen M, Nikolaev A, et al. Активация эпителиального STAT3 регулирует гомеостаз кишечника. Клеточный цикл. 2010; 9: 652–5. [PubMed] [Google Scholar] 101. Пикерт Г., Нойферт С., Леппкес М., Чжэн Ю., Витткопф Н., Варнтьен М. и др. STAT3 связывает передачу сигналов IL-22 в эпителиальных клетках кишечника с заживлением ран слизистой оболочки. J Exp Med. 2009; 206: 1465–72. [Бесплатная статья PMC] [PubMed] [Google Scholar] 102. Smith PM, Howitt MR, Panikov N, Michaud M, Gallini CA, Bohlooly YM, et al.Микробные метаболиты, короткоцепочечные жирные кислоты, регулируют гомеостаз Treg-клеток толстой кишки. Наука. 2013; 341: 569–73. [Бесплатная статья PMC] [PubMed] [Google Scholar] 103. Arpaia N, Campbell C, Fan X, Dikiy S, van der Veeken J, Deroos P и др. Метаболиты, продуцируемые комменсальными бактериями, способствуют образованию периферических регуляторных Т-клеток. Природа. 2013; 504: 451–5. [Бесплатная статья PMC] [PubMed] [Google Scholar] 104. Маркос Л.А., Готуццо Э. Кишечные простейшие инфекции у хозяина с ослабленным иммунитетом. Curr Opin Infect Dis.2013; 26: 295–301. [PubMed] [Google Scholar] 105. Raetz M, Hwang SH, Wilhelm CL, Kirkland D, Benson A, Sturge CR и др. Индуцированные паразитами клетки Th2 и дисбактериоз кишечника взаимодействуют в ИФН-гамма-зависимой элиминации клеток Панета. Nat Immunol. 2013; 14: 136–42. [Бесплатная статья PMC] [PubMed] [Google Scholar] 106. Devkota S, Wang Y, Musch MW, Leone V, Fehlner-Peach H, Nadimpalli A и др. Таурохолевая кислота, индуцированная пищевым жиром, способствует размножению патобионтов и колиту у мышей Il10 — / -. Природа. 2012; 487: 104–8.[Бесплатная статья PMC] [PubMed] [Google Scholar] 107. Юнкер Ю., Цейссиг С., Ким С.Дж., Барисани Д., Визер Х., Леффлер Д.А. и др. Ингибиторы трипсина амилазы пшеницы вызывают воспаление кишечника за счет активации толл-подобного рецептора 4. J Exp Med. 2012; 209: 2395–408. [Бесплатная статья PMC] [PubMed] [Google Scholar] 108. Соммер Ф., Бакхед Ф. Мастера кишечной микробиоты, отвечающие за развитие и физиологию хозяина. Nat Rev Microbiol. 2013; 11: 227–38. [PubMed] [Google Scholar]

    Иммунитет кишечника млекопитающих

    Biomed J. Автор рукописи; доступно в PMC 2016 15 января.

    Опубликован в окончательной отредактированной форме как:

    PMCID: PMC4714863

    NIHMSID: NIHMS609345

    Benoit Chassaing

    1 Центр воспаления, иммунитета и инфекции штата Джорджия, Институт биологических наук штата Джорджия , США

    Маниш Кумар

    2 Департамент диетологии, Государственный университет Пенсильвании, Юниверсити-Парк, штат Пенсильвания, США

    Марк Т. Бейкер

    3 Биологический факультет Университета штата Джорджия, Атланта, Джорджия, США

    Вишал Сингх

    2 Департамент диетологии, Государственный университет Пенсильвании, Юниверсити Парк, Пенсильвания, США

    Матам Виджай-Кумар

    2 Департамент диетологии Университета штата Пенсильвания, Юниверсити Парк, Пенсильвания, США

    4 Медицинский факультет Медицинского колледжа Пенсильванского государственного университета, Hers Эй, штат Пенсильвания, США

    1 Центр воспаления, иммунитета и инфекций, Институт биомедицинских наук, Университет штата Джорджия, Атланта, Джорджия, США

    2 Департамент диетологии, Университет штата Пенсильвания, Университетский парк, Пенсильвания, США

    3 Биологический факультет Университета штата Джорджия, Атланта, Джорджия, США

    4 Медицинский факультет Медицинского колледжа Университета Пенсильвании, Херши, штат Пенсильвания, США

    Для корреспонденции: Др.Матам Виджай-Кумар, Департамент диетологии, Государственный университет Пенсильвании, Пенсильвания, США. 323, лаборатория Чандли, Юниверсити-Парк, Пенсильвания 16802, США. Тел: 814-8652786; Факс: 814-8636103; [email protected] См. другие статьи в PMC, в которых цитируется опубликованная статья.

    Abstract

    Кишечник млекопитающих является крупнейшим иммунным органом в организме и состоит из клеток негемопоэтического (эпителий, клетки Панета, бокаловидные клетки) и гемопоэтического (макрофаги, дендритные клетки, Т-клетки) происхождения, а также жилище для триллионов микробов, известных под общим названием микробиота.Гомеостаз этой большой микробной биомассы является необходимым условием для поддержания здоровья хозяина за счет максимизации благоприятных симбиотических отношений и сведения к минимуму рисков проживания в такой непосредственной близости. И микробиота, и иммунная система хозяина взаимодействуют друг с другом для взаимного поддержания гомеостаза в том, что можно назвать «отношениями любви и ненависти». Кроме того, врожденное и адаптивное иммунные ответвления иммунной системы хозяина взаимодействуют и компенсируют друг друга для поддержания равновесия в очень сложной экосистеме кишечника стабильным и строгим образом.Любой дисбаланс из-за врожденного или адаптивного иммунодефицита или аберрантного иммунного ответа может привести к дисбактериозу и слабому или сильному воспалению кишечника, что в конечном итоге приведет к метаболическим заболеваниям.

    Ключевые слова: врожденный иммунитет, микробиота, NOD-подобные рецепторы, рецепторы распознавания образов, толл-подобные рецепторы

    В кишечнике млекопитающих обитает большое количество бактерий, особенно в дистальном отделе кишечника, известных под общим названием микробиота. В последнее десятилетие всплеск исследований, описывающих важность кишечной микробиоты для здоровья и болезней хозяина, убедительно продемонстрировал, что колонизация разнообразной и стабильной микробиотой абсолютно необходима для правильного развития как врожденных, так и адаптивных ветвей иммунной системы.

    Большое количество недавних исследований показывает, что метаболические функции микробиоты существенны и сопоставимы по величине с функциями печени. Микробиота может, например, влиять на состав жирных кислот сетчатки и хрусталика глаза, влиять на плотность костей и способствовать васкуляризации кишечника. [1] Этот биореактор обеспечивает необходимые питательные вещества, такие как биотин и витамин К, и переваривает сложные пищевые волокна, образуя масляную кислоту, главный источник топлива для эпителия кишечника. [2] Эоны совместной эволюции, движимые общим интересом, сделали микробиоту партнером иммунной системы в борьбе с бактериальными патогенами. В частности, микробиота действует как устойчивый конкурент за пищу, пространство и места закрепления, тем самым исключая вторжение энтеропатогенов (устойчивость к колонизации). Напротив, два недавних исследования показывают, что микробиота способствует успешной передаче патогенных вирусов, [3,4] и множественные мышиные модели воспалительных заболеваний, от колита до артрита, требуют микробиоты кишечника.Кроме того, то, что состав микробиоты является определяющим фактором серьезности заболевания, указывает на то, что микробиота также может представлять серьезную угрозу для своего хозяина.

    Поддержание гомеостаза такой сложной экосистемы потребовало разработки специализированной «иммунной системы слизистой оболочки» (MIS), которая целесообразно обнаруживает и устраняет преходящие патогены, одновременно удерживая полезных условно-патогенных микроорганизмов на правильной стороне монослоя эпителия кишечника. Другими словами, существует постоянное взаимодействие между эпителием и микробиотой, так что эпителий хорошо подготовлен к ответу на любое вторжение благодаря своей способности секретировать множество хемоаттрактантов иммунных клеток (аналогично « To to make peace,». готовиться к войне »).Поскольку это должно быть сделано при минимизации вреда для полезных микробов и тканей хозяина, MIS разработала сложную систему связи с микробиотой, в значительной степени опосредованную toll-подобным рецептором (TLR) и распознаванием паттернов рецепторов, подобных домену олигомеризации нуклеотидов (NLR). рецепторы (PRR). Похоже, что как врожденная, так и адаптивная иммунные системы эволюционировали так, чтобы для их правильного развития требовались микробные взаимодействия, [5–7] , как схематично представлено на. Подтверждая это мнение, у стерильных мышей наблюдается пониженный уровень секреторного иммуноглобулина А в кишечнике (sIgA), дефекты развития лимфоидной ткани, ассоциированной с кишечником, а также более мелкие пейеровские бляшки и мезентериальные лимфатические узлы. [8] В этом обзоре мы описываем последние достижения в области MIS млекопитающих, уделяя особое внимание взаимодействию между клетками врожденного и адаптивного иммунитета и их эффекторными молекулами в гомеостазе микробиоты, поддержании толерантности и установлении соответствующего воспалительного / воспалительного процесса. иммунный ответ против возбудителя инсульта / вторжения.

    Иммунная система слизистой оболочки кишечника. В нормальном состоянии взаимодействия PRR и микробиоты приводят к секреции антимикробных пептидов и развитию лимфоидной ткани, ассоциированной с кишечником (GALT).Перекрестное взаимодействие между микробиотой и кишечной иммунной системой вызывает гомеостатические факторы, такие как IgA и дефенсины, которые поддерживают гомеостаз микробиоты и целостность эпителиального барьера.

    Физические и химические барьеры в кишечнике

    Кишечник млекопитающих является основным местом взаимодействия между иммунной системой хозяина и содержимым просвета, включая не только пищевые антигены и токсины, но и микробиоту. [9] Иммунитет слизистой оболочки начинается в эпителии, когда микробы сталкиваются с хозяином на поверхности эпителия слизистой оболочки, пытаясь колонизировать и закрепиться.Большинство этих микробов и их метаболитов исключены из внутреннего доступа к хозяину как физическими, так и химическими барьерами. Физические барьеры включают один слой эпителиальных клеток, их межклеточные плотные соединения и слизь, покрывающую эпителиальную поверхность. [9] Кроме того, физический барьер хорошо поддерживается тонким балансом химических барьеров, таких как кислотность (низкий pH), детергенты (соли желчных кислот), протеолитические ферменты (трипсин), ферменты, разрушающие клеточные стенки (лизоцим) и антибактериальные свойства. белки (дефенсины и др.), которые контролируют микробную популяцию. Кроме того, однонаправленные перистальтические движения кишечника также помогают предотвратить проникновение микробов из плотного дистального содержимого кишечника в тонкий кишечник.

    Слой слизи: смазывающий и улавливающий барьер

    Слой слизи, покрывающий эпителиальные поверхности, смазывает кишечный тракт. Он демонстрирует липкую гелеобразующую способность из-за своей жесткой белковой структуры и высокой когезии. Слизь может рассматриваться как первая линия физической защиты кишечника от микробных патогенов, помогающая улавливать беспокоящий микроб. [10,11] Муцины, основные компоненты слизистого слоя, секретируются бокаловидными клетками, которые разбросаны среди энтероцитов по всему эпителию. Муцины представляют собой высокомолекулярные (MW) гликопротеины с обширным гликозилированием и сахарными фрагментами, присоединенными к остаткам серина или треонина O -гликозидными связями. Изменения в составе муцина могут лежать в основе этиологии некоторых заболеваний, таких как язвенный колит и гастрит, вызванный Helicobacter pylori . [12]

    В настоящее время хорошо известно, что муцины также играют более непосредственную роль в борьбе с патогенами и паразитами, играя важную роль в скоординированном иммунном ответе на инфекцию. [13,14] Они также служат местом прикрепления микроорганизмов за счет взаимодействия между многими бактериальными компонентами. Однако сверхэкспрессия некоторых белков муцина приводит к раку, [15] , в то время как дефицит приводит к воспалению кишечника и колиту (MUC-2). [16] В последнее время бокаловидные клетки также участвуют в обеспечении оральной толерантности. [17] Это исследование показывает, что в устойчивом состоянии бокаловидные клетки тонкого кишечника функционируют как каналы, доставляющие растворимые антигены с низкой молекулярной массой из просвета кишечника в лежащие в основе иммунные клетки [дендритные клетки CD103 + lamina propria (DC)].Эта преимущественная доставка антигенов к DC с толерогенными свойствами подразумевает ключевую роль бокаловидных клеток в гомеостазе кишечника. [17] Недавно было показано, что у мышей с дефицитом специфической синтазы жирных кислот толстого эпителия (FAS), неспособных ацилировать MUC-2 пальмитиновой кислотой ( S -пальмитоилирование), что приводит к нарушению секреции и функции, проявляются нарушения в слизистом барьере кишечника, а также повышенная кишечная проницаемость, колит, системное воспаление и изменения микробной экологии кишечника. [18]

    Эпителиальный барьер: функция «хранителя ворот»

    Желудочно-кишечный эпителий образует критически важный интерфейс между внутренним хозяином и содержимым просвета. Большинство эпителиев представляют собой абсорбирующие клетки (энтероциты), которые также должны поддерживать параклеточный и трансклеточный транспорт питательных веществ, электролитов и воды. Энтероциты являются одними из наиболее быстро регенерирующих клеток в организме, которым соответствует высокая скорость апоптоза, позволяющая поддерживать гомеостаз эпителиальных клеток и позволяя эпителию быстро заживать после повреждения. [19,20] Барьер, образованный эпителием, поэтому должен быть строго регулируемым и избирательно проницаемым. Стабильность и функция эпителиального барьера зависит от комплекса белков, состоящих из различных межклеточных соединений, которые включают плотные соединения (окклюдная зона и клаудины), адгезивные соединения (E-кадгерин и β-катенин) и десмосомы. [21] Соответственно, проницаемость для различных питательных веществ варьируется на отдельных участках и проявляет региональные различия в конкретных транспортируемых питательных веществах и ионах.Эпителии также оснащены многочисленными насосами, которые помогают поддерживать однонаправленные / векторные молекулы секреции. Интересно, что у мышей с дефицитом насоса с множественной лекарственной устойчивостью 1 (MDR1), участвующего в перекачивании нескольких биологических молекул, развивается спонтанное воспаление кишечника, подобное воспалительному заболеванию кишечника человека (ВЗК), которое можно предотвратить с помощью лечения антибиотиками. [22,23]

    Прямая врожденная иммунная активность эпителия кишечника

    Известно, что эпителий не только является физическим барьером для микробов и содержимого просвета, но и секретирует различные молекулы, которые помогают поддерживать гомеостаз кишечника.Другими словами, кишечный эпителий можно рассматривать как «дополнительные клетки» MIS. Эпителии секретируют обширную группу цитокинов и хемокинов, которые регулируют хемотаксис иммунных клеток, таких как нейтрофилы, макрофаги, базофилы и Т-клетки. [24] Список эффекторных молекул, специфичных для эпителия, значительно расширяется благодаря развитию микроматриц и других чувствительных аналитических методов, в том числе технологии стерилизации микробов и Cre-рекомбиназы, а также химер костного мозга.Секреция цитокинов эпителиальными клетками кишечника (IEC) наблюдалась во множестве клеточных линий со значительным перекрытием цитокинов, секретируемых иммунными клетками. Даже если их секреция цитокинов меньше, чем секреция иммунных клеток (например, макрофагов), тот факт, что IEC являются наиболее многочисленными клетками на поверхности слизистой оболочки, предполагает, что их уровень секреции оказывает важное влияние на локальные концентрации цитокинов. Однако относительный вклад цитокинов IEC четко не выявлен.

    IEC секретируют ряд хемотаксических цитокинов (хемокинов), которые направляют хемотаксис и, таким образом, контролируют популяции слизистых оболочек как врожденных, так и адаптивных иммунных клеток. Хемокин эпителиального происхождения интерлейкин-8 (IL-8, CXCL8; эквивалент мышиный хемокин, полученный из кератиноцитов, KC) [25] и хемоаттрактанты эпителиальных нейтрофилов, включая аттрактант эпителиальных нейтрофилов-78 (ENA-78, CXCL5), [26 ] Gro-a (CXCL1) и Gro-b (CXCL2), [27] регулируют хемотаксис нейтрофилов.Например, секреция ENA-78 значительно задерживается, но длится дольше, чем секреция IL-8, что позволяет предположить особую роль этих хемокинов в ответе на патогены или воспалительные стимулы. Хемокины, секретируемые эпителием, включая хемотаксический белок моноцитов (MCP-1; CCL2), воспалительный белок макрофагов (MIP1α; CCL3) и RANTES / CC L5 (регулируемый при активации и предположительно секретируемый), в первую очередь регулируют рекрутирование моноцитов. MIP1α, по-видимому, играет важную роль в рекрутировании DC слизистой оболочки. [27]

    IEC также секретирует хемокины, которые стимулируют набор различных субпопуляций Т-клеток в слизистую оболочку. Эти хемокины имеют решающее значение для управления рекрутингом интраэпителиальных лимфоцитов (IEL) и включают индуцируемый интерфероном белок (IP-10), монокин, индуцированный интерфероном (IFN) -γ (Mig), и IFN-индуцируемый α-хемоаттрактант Т-клеток (I -TAC). [28] В отличие от нейтрофилов, IEL слизистой оболочки обычно присутствуют в слизистой оболочке, что согласуется с наблюдением, что хемоаттрактанты Т-клеток экспрессируются конститутивно. [29]

    Помимо организации набора различных иммунных клеток, IEC также секретируют ряд провоспалительных цитокинов, лучшими примерами которых являются фактор некроза опухоли (TNF) -α и IL-6. [30,31] Секреция этих цитокинов влияет на местное воспалительное состояние, а также оказывает существенное влияние на системные уровни цитокинов. Например, TNF-α является не только мощным усилителем других провоспалительных цитокинов и хемокинов, но также заставляет IEC производить провоспалительные ферменты, индуцируемые синтазой оксида азота (iNOS) и циклооксигеназой-2 (COX-2), и активирует нейтрофилы для генерации большего количества активные формы кислорода (АФК) и дегрануляция при встрече с патогенными раздражителями.Врожденная иммунная активность этих IEC в сотрудничестве с профессиональными иммунными клетками может оказывать существенное влияние как на микробиоту, так и на гомеостаз ткани хозяина.

    Помимо растворимых иммуномодуляторов, IEC также регулируют множество молекул адгезии, которые влияют на взаимодействие эпителия с инфильтрирующими иммунными клетками. Считается, что экспрессия лигандов нейтрофилов в IEC играет важную роль в регуляции адгезии и трансэпителиальной миграции (диапедез) нейтрофилов.В частности, была продемонстрирована ключевая роль эпителиального CD47 и сигнального регуляторного белка (SIRP) 1a в регуляции трансмиграции нейтрофилов. [32,33] Молекула внутриклеточной адгезии 1 (ICAM-1) заметно активируется при воспалительных состояниях и, возможно, играет роль в повышении адгезии нейтрофилов к эпителию, связанной с ВЗК. [34]

    IEC также известны как секретирующие растворимые рецепторы, которые могут нейтрализовать биоактивность провоспалительных цитокинов.Например, активация инфламмасом приводит к секреции мощных провоспалительных цитокинов IL-1β и IL-18. Биологическая активность цитокинов инфламмасом тонко регулируется экспрессией эндогенных, конститутивно экспрессируемых растворимых белков-ингибиторов. Действительно, отсутствие этих антицитокинов приводит к неконтролируемому воспалению, которое вызывает повреждение тканей хозяина. [35] Хорошо изученным примером регуляции цитокинов инфламмасом является секреторный антагонист рецептора IL-1 (sIL-1Ra), который конкурирует с IL-1β за свой рецептор, тем самым ослабляя биоактивность этого мощного провоспалительного цитокина.Экспрессия IEC sIL-1Ra может быть индуцирована провоспалительными стимулами, такими как сам IL-1β и липополисахарид (LPS), а также различными иммуномодуляторами, такими как гранулоцитарно-макрофагальный колониестимулирующий фактор (GM-CSF), IFN-β. , IFN-γ и флагеллин. [36–38] Важно отметить, что sIL-1Ra экспрессируется гораздо шире, чем IL-1β, что позволяет клеткам, которые не производят IL-1β, играть роль в регуляции его активности. Точно так же эпителий может индуцировать IL-18-связывающий белок (IL-18BP) в ответ на провоспалительный цитокин IFN-γ, который является мощным ингибитором IL-18. [38]

    Ключевым аспектом роли эпителия в MIS является его способность тонко регулировать функцию и активацию иммунных клеток. Следовательно, активация и возврат в нормальное состояние должны быть тесно связаны. Например, неспособность быстро набирать иммунные клетки в ответ на патогены может сделать хозяина более восприимчивым к системной инфекции (например, мышей с дефицитом MyD88, обсуждаемых ниже). И наоборот, чрезмерное и неконтролируемое рекрутирование, особенно нейтрофилов, вероятно, будет пагубным, поскольку оно может привести к значительному повреждению ткани хозяина, как это наблюдается при хронической ВЗК.Таким образом, IEC осуществляют жесткий контроль над своими иммуномодулирующими генами MIS, особенно связанными с рекрутированием иммунных клеток, такими как нейтрофильный хемоаттрактант IL-8.

    Микроскладчатые клетки

    Другой структурно отличающийся тип эпителиальных клеток — это клетки микроскладок (М), характеризующиеся микроскладкой плазматической мембраной. Эти клетки являются иммунологическими дозорами, играющими важную роль в адаптивном иммунитете слизистых оболочек. [39] Они считаются специализированным эпителием и присутствуют на поверхности В-клеточных фолликулов [пятна Пейера и изолированные лимфоидные фолликулы (ILF)].Это основные клетки, отвечающие за отбор проб кишечной микробиоты и патогенов. [40] Структурно М-клетки имеют более короткие / скудные микроворсинки и гораздо меньше гликокаликса на своей поверхности, в отличие от других энтероцитов, которые помогают им собирать частицы из просвета и направлять их в лимфоидные ткани на своей базолатеральной стороне. Благодаря этой природе эти клетки стали центральным звеном в разработке оральных вакцин. [41] Однако они также являются одними из наиболее используемых типов клеток в просвете некоторых патогенов (например,грамм. Salmonella typhimurium, Yersinia spp, адгезивно-инвазивный Escherichia coli, реовирусов) для облегчения их инвазии. [42–44] Недавно появились сообщения о «ворсинчатых» М-клетках, которые присутствуют на ворсинчатом эпителии тонкой кишки и имеют общие функциональные и структурные характеристики с нормальными М-клетками, но лишены какой-либо лимфоидной ассоциации. [45]

    Клетки Панета

    Еще одним важным компонентом MIS являются «клетки Панета», названные в честь Джозефа Панета.Эти столбчатые клетки имеют выступающие гранулы и располагаются в основании крипт Либеркюн в тонкой кишке. Каждая крипта содержит примерно 15 стволовых клеток и 10 клеток Панета. Иногда клетки Панета также присутствуют в желудке и толстой кишке в качестве метапластической реакции на воспаление кишечника. В отличие от IECs, продолжительность жизни которых составляет 3-5 дней, клетки Панета живут относительно дольше (> 30 дней). Эти клетки имеют большие апикальные секреторные гранулы, богатые дефенсином, которые высвобождаются в узкие эпителиальные крипты посредством экзоцитоза (т.е.е. мерокринная секреция) в ответ на различные стимулы, которые включают продукты бактерий, но не продукты грибов или простейших. Клетки Панета человека экспрессируют два альфа-дефенсина: дефенсин 5 человека (HD5) и дефенсин 6 человека (HD6). [46] Они также секретируют лизоцим, секреторную фосфолипазу A2 и регенерирующий островковый белок III-альфа (RegIIIA). [47] Однако, в отличие от людей, мыши и крысы экспрессируют более двух альфа-дефенсинов. Клетки Панета мыши также секретируют многочисленные пептиды, связанные с криптдином, и РНКазу, ангиогенин 4 (для получения дополнительной информации см.[ 47 ]). Дефенсины синтезируются в виде препропептидов, которые в конечном итоге процессируются трипсином клеток Панета у людей и матриксной металлопротеиназой-7 (MMP-7) у мышей. [48] Данные экспериментальных животных показывают, что дефенсины составляют около 15% от общей антимикробной активности кишечника как у стерильных, так и у обычных мышей [49] , а концентрация дефенсинов в криптах может достигать> 10 мг. / мл. [50]

    Кишечные макрофаги

    Макрофаги (MΦ) — одни из самых распространенных лейкоцитов в собственной субэпителиальной пластинке млекопитающих, и эта популяция, вероятно, составляет самый большой резервуар макрофагов в организме.Количество MΦ в различных участках кишечника, по-видимому, тесно связано с относительной микробиологической нагрузкой, и, таким образом, они наиболее высоки в толстом кишечнике и наименьшие — в кишечнике мышей, свободных от микробов. Учитывая, что ВЗК, как полагают, вызывается аберрантным иммунным ответом на комменсальную микробиоту, которая присутствует в больших количествах в нормальной толстой кишке, и что MΦ присутствуют там постоянно, интересно подумать, почему кишечник не находится в постоянном состоянии воспаление. [51] В многочисленных исследованиях было показано, что в отличие от MΦ из других тканей, MΦ слизистой оболочки не отвечает на лиганды TLR, секретируя провоспалительные цитокины или хемокины, такие как IL-12, IL-23, TNF-α, IL-1. , IL-6 или CXCL10 (IP-10), они также не активируют костимуляторные молекулы и не генерируют продукцию ROS и оксида азота (NO) в этих условиях. [51] Однако они синтезируют IL-10 (основной противовоспалительный цитокин) конститутивно или в ответ на лиганды TLR. [52,53] Кроме того, резидентные МФ кишечника обладают высокой фагоцитарностью и экспрессируют CD36, рецептор, который способствует фагоцитозу апоптотических клеток. [51] Они также проявляют сильную бактерицидную активность, не вызывая явного воспаления, позволяя локальному MΦ действовать как брандмауэр против любых комменсальных бактерий, которые нарушают эпителиальный барьер. Они не экспрессируют высокие уровни костимулирующих молекул, таких как CD80, CD86 или CD40, но они экспрессируют цитозольные PRR, которые имеют решающее значение для их антибактериальной активности. [54] Кроме того, резидентные МФ кишечника не только вносят вклад в гомеостаз кишечника, действуя в качестве единицы утилизации отходов для местных бактерий и мертвых клеток, но также активно регулируют целостность эпителия. В результате истощение резидентного MΦ увеличивает восприимчивость мышей к экспериментально индуцированному колиту. [55,56] Экспрессия фактора транскрипции рецептора-γ, активируемого пролифератором пероксисом (PPAR-γ), посредством MΦ слизистой оболочки является альтернативным механизмом, с помощью которого они могут предотвращать локальное воспаление за счет его способности подавлять экспрессию провоспалительных генов. [57] Таким образом, MΦ в MIS можно рассматривать как функциональную подгруппу, участвующую в нормальных физиологических процессах ремоделирования ткани и избегая иммунного ответа на комменсальные микробы.

    Накопленные данные показывают, что большинство иммунных клеток в MIS способны к конститутивной секреции IL-10. Стоит отметить, что удаление IL-10 приводит к развитию спонтанного колита. [58] Кроме того, ингибирование передачи сигналов IL-10 в миелоидных клетках посредством целенаправленной делеции преобразователя сигнала и активатора транскрипции 3 (STAT3) приводит к спонтанному колиту. [59] Очевидно, что IL-10 является критическим физиологическим медиатором инерции МФ кишечника. Важный вопрос, который еще не решен, заключается в том, отражает ли измененное поведение MΦ, которое происходит во время воспаления, изменения в обычно инертном резидентном MΦ или является результатом проникновения нового, высокочувствительного профессионального MΦ. Существующие данные подтверждают последнюю идею, но неясно, принадлежат ли эти недавно прибывшие MΦ к отдельной линии от резидентного MΦ. Несколько линий доказательств указывают на то, что воспалительные MΦ происходят из недавно набранной популяции, которая происходит из циркулирующих моноцитов Ly6C hi .

    Кишечные Т-лимфоциты

    Т-клетки являются одними из наиболее распространенных лейкоцитов в субэпителиальной пластинке и играют важную роль в иммунитете кишечника млекопитающих, что подчеркивается драматическими последствиями их отсутствия, такими как инфекция вируса иммунодефицита человека (ВИЧ). Свободная от зародышей мышиная пластинка лишена Т-клеток, только первичные фолликулы в пятнах Пейера. [60,61] После колонизации бактериями популяция Т-клеток слизистой оболочки быстро увеличивается до нормального уровня, как у обычных мышей, демонстрируя, что микробные антигены или продукты необходимы для поддержания популяции Т-клеток.В целом, популяция Т-клеток у здоровых животных в основном состоит из Т-хелперных клеток 1 типа (Th2) и Т-хелперов 2 типа (Th3). В то время как болезнь Крона связана с профилем цитокинов Th2, язвенный колит имеет тенденцию к Th3. [62] Эта концепция была дополнительно усложнена описанием толеризующих регуляторных Т-клеток (Tregs) и провоспалительных клеток Th27, новой популяции Т-клеток, характеризующейся основным фактором транскрипции, связанным с RAR, орфанным рецептором гамма (ROPγt). и поверхностные маркеры IL23R и CC-хемокиновый рецептор типа 6 (CCR6). [62] Клетки Th27 дифференцируются под влиянием IL1β, IL6, IL21, IL23 и трансформирующего фактора роста бета (TGF) -β. [63–65] Клетки Th27, как известно, секретируют провоспалительные цитокины IL17A, IL17F, IL21, IL22 и IL26, а также хемокин CCL20, и несколько исследований продемонстрировали важную роль клеток Th27 в воспалении кишечника, особенно при болезни Крона. [62] Клетки Th27 играют центральную роль в нейтрализации патогенов и комменсальной микробиоты как за счет координации притока нейтрофилов, так и за счет поддержания или восстановления целостности эпителиального барьера посредством синтеза IL17 и IL22.Интересно, что эпителий слизистой оболочки экспрессирует рецепторы для этих цитокинов Th27, способствуя образованию плотных контактов, продукции антимикробных пептидов, а также выработке слизи.

    Кишечные ДК

    ДК являются наиболее мощными профессиональными антигенпрезентирующими клетками (АПК). В отличие от макрофагов, ДК могут инициировать первичный иммунный ответ, активируя наивные Т-клетки, и регулировать провоспалительные или толерогенные иммунные ответы. [66] Кроме того, DC также экспрессируют PRR для определения микробных продуктов в зависимости от окружающей среды.ДК очень гибкие и способны поляризовать иммунные ответы Th2, Th3 или Treg в зависимости от их предшествующего воздействия цитокинов / микробных лигандов. Как только DCs мигрируют в подслизистую оболочку, они становятся высокоэффективными при взятии проб содержимого кишечника через дендриты для захвата и обработки антигена [66] , происходящего через эпителиальный монослой или М-клетки. [67,68] В физиологических условиях DC играют регулирующую роль и предотвращают иммунные ответы против пищевых антигенов и микробиоты кишечника. [66] Они достигают регуляторного профиля с помощью различных сигналов [стромальный лимфопоэтин тимуса (TSLP), IL-10, TGF-β], в частности ретиноевой кислотой (RA), активной формой витамина A. В присутствии RA, кишечные DC (но не DC в других тканях) приобретают способность генерировать Treg и IgA-секретирующие B-клетки с использованием ферментов, которые превращают витамин A в RA. [69] Кишечные ДК можно отличить от ДК других тканей по (i) пониженной экспрессии PRR, (ii) пониженной экспрессии костимулирующих молекул и, таким образом, пониженной презентации антигена, (iii) более высокой продукции противовоспалительных цитокины (IL-10), (iv) способствующие дифференцировке антиген-специфических Treg и секреторных B-клеток IgA, и (v) индукция иммунной толерантности посредством экспрессии маркеров хоминга в кишечнике как в Treg, так и в IgA-секретирующих B-клетках.Любые изменения перечисленных выше характерных особенностей кишечных ДК приводят к аберрантному иммунному ответу на микробиоту, что, возможно, приводит к ВЗК.

    Врожденные лимфоидные клетки

    Врожденные лимфоидные клетки (ILC) — это недавно обнаруженные клетки врожденного иммунитета в MIS [70,71] , которые определяются отсутствием специфических рецепторов антигена и играют центральную роль в регуляции целостность барьера эпителиальных клеток кишечника, а также иммунитет, воспаление и восстановление тканей в кишечнике. [72] Истощение ILC с использованием модели мышей, не страдающих ожирением, гена-1, активирующего диабетическую рекомбинацию (NOD-Rag1 null), у мышей с двойным дефицитом общей гамма-цепи рецептора IL-2 [71] приводит к периферическому распространению комменсального бактерии и системное воспаление, которое было устранено введением IL-22, что позволяет предположить, что IL-22, продуцируемый этими клетками, играет ключевую роль в поддержании барьерной функции. [73]

    Секреторный IgA

    Самым распространенным адаптивным иммунным фактором в просвете кишечника является sIgA, который играет важную роль в гомеостазе кишечника.Он в основном секретируется в виде димера и ковалентно связан с секреторным компонентом эпителиального гликопротеина. Субэпителиальные B-клетки в кишечнике секретируют IgA, который перемещается через монослой эпителия и чья последующая секреция в просвет кишечника представляет собой главный иммунологический барьер. [74] Основные функции sIgA включают (i) защиту от энтеропатогенов (например, Salmonella, ротавирус), (ii) обеспечение коллективного иммунитета против горизонтального фекально-орального распространения энтеропатогенов и (iii) ограничение распространения кишечных инфекций. -производные антигены в кровоток (см. [75] для подробностей). Люминальный sIgA играет важную роль в защите от Vibrio cholera и энтеротоксигенной E. coli. Кроме того, микробиота хозяина играет ключевую роль в секреции IgA, поскольку давно известно, что мыши-гнотобиоты обнаруживают поразительно пониженные уровни sIgA в фекалиях.

    IEC, которые находятся в непосредственной близости с микробиотой, играют роль в процессе секреции IgA. Лучшим примером является то, что развитие ILF из криптопатчей зависит от восприятия микробиоты нуклеотид-связывающим белком 1 домена олигомеризации (NOD1), что приводит к секреции хемоаттрактанта B-клеток CCL20 посредством IEC.ILF являются преобладающими сайтами продукции sIgA независимо от Т-клеток. Воспаление кишечника значительно увеличивает секрецию sIgA в просвет. Например, у мышей, экспрессирующих конститутивно активную форму TLR-4, отсутствовал спонтанный колит, но наблюдалось увеличение рекрутирования В-клеток и продукции трофических факторов, что приводило к увеличению продукции sIgA. [76] Было показано, что в дополнение к влиянию на рекрутирование B-клеток, IECs конститутивно продуцируют факторы, которые напрямую стимулируют продукцию IgA посредством продукции IL-6, и индуцируют B-клеточный IgA 2 переключение классов посредством стимуляции пролиферации -индуцирующий лиганд (APRIL).Передача сигналов врожденного иммунитета через TLR также увеличивает транзит sIgA в просвет, поскольку воздействие на IECs LPS или инактивированных нагреванием E. coli приводит к повышенной экспрессии полимерного рецептора Ig, который связывается с субэпителиальным IgA и перемещает его через эпителий. . Несмотря на то, что несколько исследований показывают, что ДК, взявшие образцы просветных антигенов, являются движущей силой секреции sIgA, эпителий, подвергшийся воздействию микробов, также может влиять на этот процесс, что еще больше подчеркивает важность IEC в MIS.Tregs также играют роль в индукции sIgA, и индукция Treg совпадает с мощной индукцией sIgA [77] при колонизации микробиоты. И люди, и мыши, у которых выборочно отсутствует IgA, проявляют слабые симптомы, поскольку IgM может компенсировать дефицит IgA. [78,79]

    Микробиота способствует развитию хозяина MIS

    Кишечник млекопитающих населен большим разнообразным сообществом микробов, которые вместе известны как кишечная микробиота; он содержит примерно 10 14 бактерий массой 1-2 кг и включает 6-10 основных типов и около 3000 видов. [80] Считается, что состав микробиоты остается стабильным на протяжении всей жизни хозяина, даже при резких изменениях в диете и уровне физической активности, во время беременности и при использовании антибиотиков широкого спектра действия. [81,82]

    Интересно, что «стерильные» (также называемые гнотобиотиками) мыши, лишенные микробиоты, имеют значительные иммунные и метаболические дефекты. [83] Однако накопленные данные на различных моделях мышей с иммунодефицитом показывают, что измененная микробиота играет центральную роль в возникновении воспаления кишечника и метаболических заболеваний. [84] Вместе эти исследования предполагают, что гомеостаз микробиоты необходим для поддержания благоприятных симбиотических отношений.

    С этой целью MIS разработала несколько способов поддержания гомеостаза микробиоты и хозяина и защиты от патогенов. PRR врожденной иммунной системы, особенно TLR и NOD-подобные рецепторы (NLR), играют важную роль в этих процессах. И TLR, и NLR распознают множество широко консервативных микробных компонентов.

    Распознавание образов в кишечнике

    Учитывая потенциально подавляющую микробную биомассу в кишечнике и тот факт, что несколько PRR могут ощущать свои родственные агонисты на пикомолярных уровнях, хозяин разработал ряд эффективных механизмов для предотвращения постоянной / повторяющейся активации PRR, в то время как поддержание способности активировать PRR, когда это необходимо, чтобы максимизировать преимущества, предоставляемые микробиотической стабильностью [и].

    Таблица 1

    Лиганды рецепторов распознавания образов

    Рецептор Микробный продукт Ссылки
    TLR-1 (с TLR-2) липопротеины липопротеины Микобактерии липопротеины и др. , 2002
    Shimizu, Kida et al. , 2007
    TLR-2 (с TLR-1 или TLR-6) грамположительные бактерии
    Пептидогликан, липотейхоевая кислота
    Зимозан, липарабиноманнан
    Бактериальные гликолипиды, дрожжевой краузин 43 GPI
    354 ЛПС из Leptospira interrogans
    ЛПС из Porphyromonas gingivalis (более цилиндрический)
    Aliprantis, Yang et al., 1999; Schwandner, Dziarski et al. , 1999; Такеучи, Хосино и др. , 1999; Хаджар, О’Махони и др. , 2001; Opitz, Schroder et al. , 2001; Werts, Tapping et al. , 2001; Коэльо, Кляйн и др. , 2002; Massari, Henneke et al. , 2002
    TLR-3 Вирусная дцРНК, синтетическая полиинозиновая кислота: цитидиловая кислота (поли I: C) Alexopoulou, Holt et al. , 2001
    TLR-4 Грамотрицательные бактерии
    ЛПС (коническая форма), пневмолизин
    Липид А (строго цилиндрический, антагонист)
    ЛПС из Rhodobacter sphaeroides (строго цилиндрический)
    Flavolipium mens.
    Респираторно-синцитиальный вирусный белок F
    Aspergillus fumigatus hyphae
    HSP 60 и 70, гиалуронан
    Домен фибронектина A, фибриноген
    Некротические клетки, насыщенные жирные кислоты, таксол (только у мышей)
    Poltora35., 1998; Кавасаки, Акаши и др. , 2000; Курт-Джонс, Попова и др. , 2000; Охаши, Буркарт и др. , 2000; Берд-Лейфер, Блок и др. , 2001; Окамура, Ватари и др. , 2001; Смайли, Кинг и др. , 2001; Bulut, Faure et al. , 2002; Джонсон, Брун и др. , 2002; Расса, Мейерс и др. , 2002; Termeer, Benedix et al. , 2002; Vabulas, Ahmad-Nejad et al. , 2002; Хуанг, Рутковски и др., 2012
    TLR-5 Флагеллин Hayashi, Smith et al. , 2001
    TLR-6 (с TLR-2) Липопротеины микоплазмы, липотейхоевая кислота, пептидогликан Schwandner, Dziarski et al. , 1999; Морр, Такеучи и др. , 2002
    TLR-7 и TLR-8 Одноцепочечная РНК, имидазохиналоны Diebold, Kaisho et al. , 2004; Heil, Hemmi et al., 2004
    TLR-9 CpG ДНК, гемозоин Hemmi, Takeuchi et al. , 2000
    TLR-10 Неизвестно
    TLR-11 Уропатогенные бактерии
    Профилин-подобная молекула белка в Toxoplasma gondii Zhang 5, Zhang et al. , 2004; Кобланский, Янкович и др. , 2013
    TLR-12 Профилин-подобная молекула белка в Toxoplasma gondii Koblansky, Jankovic et al., 2013
    RIG-1 5′-трифосфорилированная дцРНК Yoneyama, Kikuchi et al. , 2004
    MDA-5 Длинная дцРНК Kato, Takeuchi et al. , 2008
    Протеинкиназа R dsRNA Williams 2001
    Dectin-I β-глюканы Brown, Taylor et al. , 2002
    Рецептор маннозы Липарабиноманнан Schlesinger, Hull et al., 1994
    рецептор f-MLP f-MLP Boulay, Tardif et al. , 1990
    Moesin LPS Amar, Oyaisu et al. , 2001; Иончева, Амар и др. , 2004

    Таблица 2

    Нуклеотидсвязывающие и олигомеризационные домеподобные рецепторы

    Семейство Рецептор Лиганды Ссылки ??
    NLRB NAIPs Флагеллин, палочковидные белки Kofoed and Vance 2011
    NLRC NOD-1 γ-d-iED-Dluso-DAP (9ED-Dluso) , мезо -DAP, d-лактил-l-ala-γ-Glu- мезо -DAP-Gly (FK156), гептанолил-γ-Glu- мезо -DAP-d-ala (FK565) Chamaillard, Hashimoto et al., 2003; Girardin, Travassos et al. , 2003; Wilmanski, Petnicki-Ocwieja et al. , 2008
    NOD-2 Мурамилдипептид (MDP), MurNAc-l-Ala-γ-d-Glu-l-Lys (M-TRILys) Girardin, Boneca et al. , 2003; Girardin, Travassos et al. , 2003
    NLRC3 / C5 / X1 ??
    NLRC4 Флагеллин, система секреции бактерий 3-го типа (T3SS) Lightfield, Persson et al., 2008; Мяо, Мао и др. , 2010
    NLRP NLRP1 Бактериальные токсины, MDP, пониженный уровень цитозольного АТФ (?) Boyden and Dietrich 2006; Faustin, Lartigue et al. , 2007; Frew, Joag et al. , 2012; Левинсон, Ньюман и др. , 2012; Liao and Mogridge 2013
    NLRP3 Токсины, бактериальная и вирусная РНК, oxMito-ДНК, церамид, кардиолипин, отток K +, митохондриальные / лизосомные нарушения, ROS, кристаллы / агрегаты, передача сигналов Ca ++, Ex-ATP, кристаллы кремнезема и соли алюминия Hornung, Bauernfeind et al., 2008; Tschopp and Schroder 2010; Leemans, Cassel et al. , 2011
    NLRP6 Бактериальные продукты (?) Ананд, Малиредди и др. , 2012; Anand and Kanneganti 2013
    NLRP7 Бактериальные ацилированные липопептиды (acLP) Khare, Dorfleutner et al. , 2012
    NLRP10 ??
    NLRP11 ??
    NLRP12 Ацилированный липид A Lupfer and Kanneganti 2013
    NLRX NLRX1 Poly I: C 35, 2012

    Помимо физических препятствий для активации PRR обильными микробными лигандами просвета [и], а именно вышеупомянутым толстым слоем слизи, насыщенным антибактериальными соединениями, существуют дополнительные механизмы для ингибирования аберрантной активации PRR в кишечнике. Одним из таких механизмов является избирательность кишечника в отношении типов клеток и условий, в которых экспрессируются TLR. Например, TLR 2 и 4, рецепторы для компонентов стенки бактериальной клетки, пептидогликана и LPS, соответственно, почти не экспрессируются в здоровых IEC, но активируются в условиях, связанных с IBD. [85] Кроме того, активация TLR-4, наиболее провоспалительного из PRR, в IEC также предотвращается за счет ограничения доступности корецепторов, фактора миелоидной дифференцировки 2 (MD-2), CD14 и LPS- связывающий белок. [86] TLR 2 и 4 также экспрессируются на более высоких уровнях с помощью IECs, которые еще не мигрировали вверх по ворсинкам, гарантируя, что надежная активация этих PRR происходит только в том случае, если крипта, которая обычно не колонизируется, находится под угрозой. [87] Кроме того, рецептор флагеллина, TLR-5, экспрессируется только на базолатеральной стороне IECs, стратегия, которая позволяет хозяину генерировать ответ только на инвазивные жгутиковые микробы. [88] TLR-9 уникален среди TLR в том смысле, что он способен подавлять передачу сигналов через все TLR. В то время как базолатеральная активация TLR-9 микробиотной ДНК вызывает классический ядерный фактор, усиливающий каппа-легкую цепь активированных В-клеток (NF-κB), опосредованный воспалительным ответом, апикальный TLR-9 ослабляет такой ответ через альтернативный путь передачи сигналов, который притупляет Активность ИЛ-8, ингибирующая хемотаксис нейтрофилов. [89,90] Кроме того, постоянное воздействие их соответствующих лигандов может привести к иммунологической толерантности, механизму, который также может защитить от аберрантного воспаления и даже аутоиммунитета. [91] Таким образом, врожденный иммунный ответ в кишечнике можно рассматривать как предотвращение чрезмерной активации PRR, которая могла бы возникнуть, если микробиота не управлялась должным образом. Такой жесткий контроль за взаимодействиями микробиоты и PRR служит для ограничения аберрантного воспаления.

    Сходным образом нуклеотидсвязывающие и олигомеризационные домены (NOD) -подобные рецепторы (NLR) эволюционировали в IEC, чтобы избежать сверхактивных воспалительных реакций на резидентную микробиоту, а также для сохранения целостности и функций эпителиального барьера путем поддержания гомеостаза.Недавние исследования кишечной микробиоты в контексте дефицита NLR показывают, что врожденные изменения плотности или численности бактерий могут лежать в основе развития воспалительных заболеваний. Инфламмасомы стали центральными регуляторами кишечной инфекции, иммунитета и воспаления. В дополнение к опосредованию целостности кишечного эпителия, антимикробным ответам и инициированию воспаления посредством генерации цитокинов IL-1β и IL-18, инфламмасома, по-видимому, играет ключевую роль в контроле состава кишечной микробиоты. [92] Мыши с дефицитом инфламмасомы демонстрируют аберрантное микробное сообщество, которое преимущественно передается здоровым мышам, что приводит к передаче неалкогольной жировой болезни печени (НАЖБП), ожирению, воспалению кишечника и раку. [93,94]

    Факторы транскрипции в кишечном иммунитете

    Сигнальный путь NF-κB в эпителии кишечника имеет решающее значение не только для секреции множества хемоаттрактантов, но также для индукции противомикробных и провоспалительных ферментов, таким образом, играет ключевую роль в эпителиальном гомеостазе.Соответственно, IEC-специфическое ингибирование NF-κB посредством условного удаления эссенциального модулятора NF-κB (NEMO) (IκB-киназа-гамма, необходимого для активации NF-κB) вызывает спонтанное хроническое воспаление кишечника у мышей. [95] Дефицит NF-κB привел к апоптозу эпителиальных клеток толстой кишки, сопровождающемуся нарушением экспрессии антимикробных пептидов и транслокацией бактерий в слизистую оболочку. [95] Одновременно этот эпителиальный дефект вызвал хронический воспалительный ответ в толстой кишке, в котором сначала преобладали клетки врожденного иммунитета, но позже вовлекались и Т-лимфоциты.Важно отметить, что дефицит гена, кодирующего адаптерный белок MyD88, предотвращает развитие воспаления кишечника, демонстрируя, что активация TLR кишечными бактериями важна для патогенеза заболевания. [95] Однако, даже если активация TLR кишечными бактериями важна для патогенеза заболевания, передачу сигналов TLR следует рассматривать скорее как полезный путь, который также может стать вредным в ситуации иммунодефицита, такой как делеция NEMO. Более того, активация TLR микробиотой имеет решающее значение для защиты от повреждения кишечника и связанной с этим смертности, выявляя защитную функцию TLR при взаимодействии между хозяином и микробом. [96,97] Помимо NF-κB, несколько других факторов транскрипции, таких как T-bet и семейство STAT, также играют роль в гомеостазе кишечника. [98–101]

    Бактериальные метаболиты в развитии MIS

    Известно, что микробиота играет ключевую роль в развитии собственной лимфоидной системы кишечника и гомеостаза кишечника. Однако механизм, с помощью которого сигналы и метаболиты микробиоты управляют гомеостазом кишечника, был в значительной степени неизвестен. В недавнем исследовании Smith et al. обнаружил, что короткоцепочечные жирные кислоты (SCFA), такие как ацетат, бутират и пропионат, образующиеся в результате бактериальной ферментации пищевых волокон, играют ключевую роль в расширении Treg-клеток кишечной, но не внекишечной лимфоидной ткани. [102] SCFAs специфически увеличивают количество как у гнотобиотических, так и у обычных мышей. Кроме того, с помощью экспериментов по совместному культивированию было обнаружено, что SCFAs улучшают ингибирующую активность Treg в отношении CD4 +. [102] В модели хронического колита с адоптивным переносом Т-клеток мыши, предварительно обработанные только пропионатом или смесью SCFA, были существенно защищены по сравнению с контрольными мышами.В аналогичной строке Arpaia et al. обнаружил, что бутират, продуцируемый микробиотой, способствует экстратимической генерации Treg-клеток. [103] Кроме того, пропионат усиливал de novo генерацию Treg на периферии. Эти исследования демонстрируют, что не только ассоциированные с бактериями лиганды могут участвовать в правильном развитии MIS хозяина, но также их метаболиты могут глубоко влиять на генерацию ключевых популяций регуляторных клеток адаптивной иммунной системы.

    Кишечный иммунитет к небактериальным организмам

    Иммунная система кишечника способна вызывать иммунные ответы не только на бактерии, но и на множество простейших паразитов, таких как Toxoplasma, Entoamoeba, и Giardia, , количество которых растет. создает серьезную проблему, особенно у хозяев с ослабленным иммунитетом. [104] В то время как восприимчивость к хронической инфекции передается за счет цитокиновых ответов Th2 (характеризующихся продуцированием IL-12, IL-18 и IFN-γ), иммунитет к взрослым нематодным червям, обитающим в кишечнике, критически зависит от Th3 цитокиновый ответ (контролируемый цитокинами IL-4, IL-5, IL-9 и IL-13).Недавно было показано, что заражение мышей Toxoplasma gondii приводит к дисбактериозу микробиоты, [105] , характеризующемуся временным обогащением Enterobacteriaceae, принадлежащими Proteobacteria. Ключевое наблюдение в этом исследовании заключается в том, что мышей, инфицированных T. gondii , демонстрировали потерю клеток Панета в тонком кишечнике из-за повреждения митохондрий, которое зависело от микробиоты, передачи сигналов TLR-11, IFN-γ и MyD88 в CD4 + Т-клетках. . [105] Интересно, что т.gondii -индуцированный дисбиоз микробиоты в некоторой степени похож на микробиотические изменения, наблюдаемые на животных моделях воспаления кишечника и при ВЗК человека, подчеркивая условно-патогенную активность семейства Enterobacteriaceae, в частности E. coli . В совокупности это исследование демонстрирует, что TLR не только помогают сохранить микробиотический гомеостаз, но также влияют на дисбактериоз, повреждая клетки-хозяева, которые обычно секретируют антимикробные пептиды.

    Диета и иммунитет кишечника

    В настоящее время многочисленные исследования показали, что диета прямо или косвенно играет важную роль в раннем развитии иммунной системы кишечника.В частности, помимо основных макроэлементов, большое влияние на MIS могут оказывать такие микроэлементы, как витамины A и D, и минералы, такие как железо. Недавнее добавление к списку все более заметных диетических компонентов — это химические вещества, присутствующие в овощах, в частности, из семейства Brassicaceae, а также лактоза в молоке. Некоторые диетические факторы также способствуют патогенезу заболевания, в том числе молочный жир, действующий как колитогенный фактор у восприимчивых мышей, способствуя росту конкретной бактерии, Bilophila wadsworthia . [106]

    Давно известно, что богатые глютеном белки (пшеница, рожь) являются движущими факторами в этиологии целиакии (БК). Хотя вклад адаптивного иммунитета в патогенез CD хорошо известен, доказательства прямого участия врожденного иммунитета, который необходим для установления связи адаптивного иммунитета, отсутствуют. Недавнее исследование устраняет этот пробел, демонстрируя, что молекулы устойчивости к вредителям [ингибиторы α-амилазы / трипсина (ATI) CM3 и 0,19] в пшенице действуют как сильные активаторы моноцитов, макрофагов и DC через TLR-4 – MD2 – CD14, таким образом, инициирование иммунного ответа, который приводит к активации адаптивного иммунитета (Т-лимфоцитов), который управляет патогенезом CD. [107]

    Заключение

    В заключение, кишечную иммунную систему млекопитающих следует рассматривать как сложное взаимодействие между физическими, химическими и клеточными барьерами, обширным сообществом бактерий и множеством иммунных клеток хозяина, которые опосредуют врожденные и адаптивный иммунитет. Кишечная микробиота помогает в правильном развитии иммунной системы хозяина, которая, в свою очередь, регулирует гомеостаз микробиоты. [108] Накопление доказательств за последнее десятилетие показывает, что взаимодействие MIS и микробиоты должно быть точно сбалансировано, и любые нарушения этого взаимодействия могут привести к микробиотическому и иммунному дисбиозу, ведущему к воспалительным нарушениям.Быстрый всплеск возникающих заболеваний нового поколения, таких как ВЗК, ревматоидный артрит, сердечно-сосудистые заболевания и метаболический синдром, побудил исследователей изучить их этиологию во многих направлениях, таких как генетика, диета и факторы окружающей среды, а также взаимодействия MIS и микробиоты. . Кроме того, соблюдение строгих гигиенических и санитарных условий и потребление продуктов с высокой степенью обработки, содержащих большое количество жиров, углеводов и клетчатки, с многочисленными пищевыми добавками и консервантами, может быть причиной изменения микробного состава, метаболизма и взаимодействия с иммунитетом хозяина.Почти все вышеперечисленные заболевания характеризуются как местным, так и системным хроническим или субклиническим воспалением слабой степени, при котором воспаление возникает в кишечнике в результате взаимодействия между MIS хозяина и микробиотой. Гиппократ (460–370 гг. До н.э.) утверждал: «Все болезни начинаются в кишечнике».

    Ссылки

    1. Оресик М., Сеппанен-Лааксо Т., Йетукури Л., Бэкхед Ф., Ханнинен В. Микробиота кишечника влияет на липидный состав хрусталика и сетчатки. Exp Eye Res. 2009; 89: 604–7. [PubMed] [Google Scholar] 2.Hamer HM, Jonkers D, Venema K, Vanhoutvin S, Troost FJ, Brummer RJ. Обзорная статья: роль бутирата в функции толстой кишки. Алимент Pharmacol Ther. 2008; 27: 104–19. [PubMed] [Google Scholar] 3. Кейн М., Кейс Л.К., Копаски К., Козлова А., МакДирмид С., Червонский А.В. и др. Успешная передача ретровируса зависит от комменсальной микробиоты. Наука. 2011; 334: 245–9. [Бесплатная статья PMC] [PubMed] [Google Scholar] 4. Kuss SK, Best GT, Etheredge CA, Pruijssers AJ, Fierson JM, Hooper LV и др. Кишечная микробиота способствует репликации кишечного вируса и системному патогенезу.Наука. 2011; 334: 249–52. [Бесплатная статья PMC] [PubMed] [Google Scholar] 7. Slack E, Hapfelmeier S, Stecher B, Velykoredko Y, Stoel M, Lawson MA и др. Врожденный и адаптивный иммунитет гибко взаимодействуют, чтобы поддерживать мутуализм хозяина и микробиоты. Наука. 2009; 325: 617–20. [Бесплатная статья PMC] [PubMed] [Google Scholar] 8. Hoshi H, Aijima H, Horie K, Nagata H, Kaneko T., Ikeda T. Лимфатические фолликулы и зародышевые центры в подколенных лимфатических узлах и других лимфоидных тканях стерильных и обычных крыс. Tohoku J Exp Med.1992; 166: 297–307. [PubMed] [Google Scholar] 9. Тернер-младший. Барьерная функция слизистой оболочки кишечника при здоровье и болезни. Nat Rev Immunol. 2009; 9: 799–809. [PubMed] [Google Scholar] 10. Йоханссон М.Э., Филлипсон М., Петерссон Дж., Вельчич А., Холм Л., Ханссон Г.С. Внутренний из двух слоев слизи, зависимой от муцина Muc2 в толстой кишке, лишен бактерий. Proc Natl Acad Sci USA. 2008; 105: 15064–9. [Бесплатная статья PMC] [PubMed] [Google Scholar] 13. Hasnain SZ, Gallagher AL, Grencis RK, Thornton DJ. Новая роль муцинов в иммунитете: данные о желудочно-кишечной нематодной инфекции.Int J Biochem Cell Biol. 2013; 45: 364–74. [PubMed] [Google Scholar] 14. Шекельс Л.Л., Анвей Р.Э., Лин Дж., Кеннеди М.В., Гарсайд П., Лоуренс К.Э. и др. Скоординированная экспрессия гена муцина Muc2 и Muc3 при инфекции Trichinella spiralis у мышей дикого типа и мышей с дефицитом цитокинов. Dig Dis Sci. 2001; 46: 1757–64. [PubMed] [Google Scholar] 15. Пиллаи К., Пургхолами М.Х., Чуа Т.К., Моррис Д.Л. MUC1 как потенциальная мишень в противоопухолевой терапии. Am J Clin Oncol. DOI 2013: 10.1097 / COC.0b013e31828f5a07. [PubMed] [CrossRef] [Google Scholar] 16.Ван дер Слуис М., Де Конинг Б.А., Де Брюйн А.С., Вельчич А., Мейеринк Дж. П., Ван Гудувер Дж. Б. и др. У мышей с дефицитом Muc2 спонтанно развивается колит, что указывает на то, что MUC2 имеет решающее значение для защиты толстой кишки. Гастроэнтерология. 2006; 131: 117–29. [PubMed] [Google Scholar] 17. McDole JR, Wheeler LW, McDonald KG, Wang B, Konjufca V, Knoop KA и др. Бокаловидные клетки доставляют люминальный антиген к дендритным клеткам CD103 + в тонком кишечнике. Природа. 2012; 483: 345–9. [Бесплатная статья PMC] [PubMed] [Google Scholar] 18. Вэй X, Ян З., Рей Ф. Е., Ридаура В. К., Дэвидсон Н. О., Гордон Дж. И. и др.Синтаза жирных кислот модулирует функцию кишечного барьера посредством пальмитоилирования муцина 2. Клеточный микроб-хозяин. 2012; 11: 140–52. [Бесплатная статья PMC] [PubMed] [Google Scholar] 19. Вареди М., Грили Г. Х., младший, Херндон Д. Н., Англичанин Е. В.. Циркулирующий фактор (ы), вызванный термическим повреждением, ставит под угрозу морфологию, пролиферацию и миграцию кишечных клеток. Am J Physiol. 1999; 277: G175–82. [PubMed] [Google Scholar] 20. Гордон Дж. И., Шмидт Г. Х., Рот К. А.. Исследования стволовых клеток кишечника на нормальных, химерных и трансгенных мышах.FASEB J. 1992; 6: 3039–50. [PubMed] [Google Scholar] 21. Митич Л.Л., Андерсон Дж. М.. Молекулярная архитектура плотных контактов. Annu Rev Physiol. 1998. 60: 121–42. [PubMed] [Google Scholar] 22. Брант С.Р., Панхуисен К.И., Николае Д., Редди Д.М., Бонен Д.К., Каралюкас Р. и др. Полиморфизм MDR1 Ala893 связан с воспалительным заболеванием кишечника. Am J Hum Genet. 2003. 73: 1282–92. [Бесплатная статья PMC] [PubMed] [Google Scholar] 23. Панвала С.М., Джонс Дж. К., Вини Дж. Л.. Новая модель воспалительного заболевания кишечника: у мышей с дефицитом гена множественной лекарственной устойчивости mdr1a спонтанно развивается колит.J Immunol. 1998. 161: 5733–44. [PubMed] [Google Scholar] 25. Маккормик Б.А., Колган С.П., Дельп-Арчер С., Миллер С.И., Мадара Дж.Л. Присоединение Salmonella typhimurium к монослоям кишечного эпителия человека: трансклеточная передача сигналов субэпителиальным нейтрофилам. J Cell Biol. 1993; 123: 895–907. [Бесплатная статья PMC] [PubMed] [Google Scholar] 26. Китс С., Китс А.С., Мидзогучи Е., Бхан А., Келли С.П. Энтероциты являются основным источником хемокина ENA-78 при нормальной толстой кишке и при язвенном колите. Am J Physiol. 1997; 273: G75–82.[PubMed] [Google Scholar] 27. Двинелл МБ, Йохансен П.А., Смит Дж. М.. Иммунобиология эпителиальных хемокинов слизистой оболочки кишечника. Операция. 2003. 133: 601–7. [PubMed] [Google Scholar] 28. Гасперини С., Марчи М., Кальцетти Ф., Лауданна С., Вичентини Л., Олсен Х. и др. Экспрессия генов и продукция монокина, индуцированная IFN-гамма (MIG), IFN-индуцируемым альфа-хемоаттрактантом T-клеток (I-TAC) и IFN-гамма-индуцируемым протеином-10 (IP-10) хемокинами нейтрофилами человека. J Immunol. 1999; 162: 4928–37. [PubMed] [Google Scholar] 29.Шибахара Т., Уилкокс Дж. Н., Коус Т., Мадара Дж. Л.. Характеристика эпителиальных хемоаттрактантов для интраэпителиальных лимфоцитов кишечника человека. Гастроэнтерология. 2001; 120: 60–70. [PubMed] [Google Scholar] 30. Кромвель О., Хамид К., Корриган С.Дж., Барканс Дж., Мэн К., Коллинз П.Д. и др. Экспрессия и генерация интерлейкина-8, IL-6 и фактора, стимулирующего колонию гранулоцитов-макрофагов, бронхиальными эпителиальными клетками и усиление IL-1 бета и фактором некроза опухоли альфа. Иммунология. 1992; 77: 330–7. [Бесплатная статья PMC] [PubMed] [Google Scholar] 31.Ситараман С.В., Мерлин Д., Ван Л., Вонг М., Гевирц А.Т., Си-Тахар М. и др. Нейтрофил-эпителиальный перекрестный контакт на поверхности просвета кишечника, опосредованный реципрокной секрецией аденозина и ИЛ-6. J Clin Invest. 2001; 107: 861–9. [Бесплатная статья PMC] [PubMed] [Google Scholar] 32. Лю Й., Буринг Х. Дж., Зен К., Burst SL, Шнелл Ф. Дж., Уильямс И. Р. и др. Сигнальный регуляторный белок (SIRPalpha), клеточный лиганд для CD47, регулирует трансмиграцию нейтрофилов. J Biol Chem. 2002; 277: 10028–36. [PubMed] [Google Scholar] 33.Parkos CA, Colgan SP, Liang TW, Nusrat A, Bacarra AE, Carnes DK, et al. CD47 опосредует постадгезивные события, необходимые для миграции нейтрофилов через поляризованный эпителий кишечника. J Cell Biol. 1996; 132: 437–50. [Бесплатная статья PMC] [PubMed] [Google Scholar] 34. Colgan SP, Parkos CA, Delp C, Arnaout MA, Madara JL. Миграция нейтрофилов через культивируемые монослои кишечного эпителия модулируется воздействием на эпителий IFN-гамма сильно поляризованным образом. J Cell Biol. 1993; 120: 785–98. [Бесплатная статья PMC] [PubMed] [Google Scholar] 35.Аксентиевич И., Мастерс С.Л., Фергюсон П.Дж., Дэнси П., Френкель Дж., Ван Ройен-Керкхофф А. и др. Аутовоспалительное заболевание с дефицитом антагониста рецепторов интерлейкина-1. N Engl J Med. 2009; 360: 2426–37. [Бесплатная статья PMC] [PubMed] [Google Scholar] 36. Аренд В.П., Маляк М., Гатридж С.Дж., Габай С. Антагонист рецептора интерлейкина-1: роль в биологии. Анну Рев Иммунол. 1998. 16: 27–55. [PubMed] [Google Scholar] 37. Молнарфи Н., Хика-Носпикель Н., Груаз Л., Дайер Дж. М., Бургер Д. Производство антагониста рецептора ИЛ-1 в моноцитах человека, стимулированных ИФН-бета, зависит от активации фосфатидилинозитол-3-киназы, но не STAT1.J Immunol. 2005; 174: 2974–80. [PubMed] [Google Scholar] 38. Карвалью Ф.А., Эйткен Д.Д., Гевиртц А.Т., Виджай-Кумар М. Активация TLR5 индуцирует секреторный антагонист рецептора интерлейкина-1 (sIL-1Ra) и снижает повреждение тканей, связанное с воспалением массом. Mucosal Immunol. 2011; 4: 102–11. [Бесплатная статья PMC] [PubMed] [Google Scholar] 40. Kraehenbuhl JP, Neutra MR. Эпителиальные М-клетки: дифференциация и функция. Annu Rev Cell Dev Biol. 2000; 16: 301–32. [PubMed] [Google Scholar] 41. Джепсон М.А., Кларк М.А., Херст Б.Н. Нацеливание на М-клетки лектинами: стратегия вакцинации слизистых оболочек и доставки лекарств.Adv Drug Deliv Rev. 2004; 56: 511–25. [PubMed] [Google Scholar] 42. Пикард Ю.М., Червонский А.В. Забор кишечной микробиоты эпителиальными М-клетками. Curr Gastroenterol Rep. 2010; 12: 331–9. [PubMed] [Google Scholar] 43. Баумлер А.Дж., Цолис Р.М., Хеффрон Ф. Фимбриальный оперон lpf опосредует адгезию Salmonella typhimurium к мышиным пятнам Пейера. Proc Natl Acad Sci USA. 1996; 93: 279–83. [Бесплатная статья PMC] [PubMed] [Google Scholar] 44. Chassaing B, Rolhion N, de Vallee A, Salim SY, Prorok-Hamon M, Neut C и др.Связанные с болезнью Крона адгезивно-инвазивные бактерии E. coli нацелены на мышиные и человеческие пятна Пейера через длинные полярные фимбрии. J Clin Invest. 2011; 121: 966–75. [Бесплатная статья PMC] [PubMed] [Google Scholar] 45. Jang MH, Kweon MN, Iwatani K, Yamamoto M, Terahara K, Sasakawa C и др. М-клетки ворсинок кишечника: сайт проникновения антигена в эпителий слизистой оболочки. Proc Natl Acad Sci USA. 2004. 101: 6110–5. [Бесплатная статья PMC] [PubMed] [Google Scholar] 47. Clevers HC, Bevins CL. Клетки Панета: Маэстро крипт тонкого кишечника.Annu Rev Physiol. 2013; 75: 289–311. [PubMed] [Google Scholar] 48. Гош Д., Портер Э., Шен Б., Ли С.К., Уилк Д., Дразба Дж. И др. Трипсин клеток Панета является процессирующим ферментом дефенсина-5 человека. Nat Immunol. 2002; 3: 583–90. [PubMed] [Google Scholar] 49. Пуцеп К., Аксельссон Л.Г., Боман А., Мидтведт Т., Нормарк С., Боман Х.Г. и др. Свободные от зародышей и колонизированные мыши производят одни и те же продукты из кишечных продефенсинов. J Biol Chem. 2000; 275: 40478–82. [PubMed] [Google Scholar] 50. Ayabe T, Satchell DP, Wilson CL, Parks WC, Selsted ME, Ouellette AJ.Секреция микробицидных альфа-дефенсинов кишечными клетками Панета в ответ на бактерии. Nat Immunol. 2000; 1: 113–8. [PubMed] [Google Scholar] 51. Смитис Л. Е., Продавцы М., Клементс Р. Х., Мостеллер-Барнум М., Менг Г., Бенджамин У. С. и др. Макрофаги кишечника человека проявляют сильную воспалительную анергию, несмотря на активную фагоцитарную и бактерицидную активность. J Clin Invest. 2005; 115: 66–75. [Бесплатная статья PMC] [PubMed] [Google Scholar] 53. Мурай М., Туровская О., Ким Дж., Мадан Р., Карп С.Л., Черутре Х. и др.Интерлейкин 10 действует на регуляторные Т-клетки, поддерживая экспрессию фактора транскрипции Foxp3 и подавляя функцию у мышей с колитом. Nat Immunol. 2009. 10: 1178–84. [Бесплатная статья PMC] [PubMed] [Google Scholar] 54. Ругтвейт Дж., Бакка А., Брандтзаег П. Дифференциальное распределение B7.1 (CD80) и B7. 2 (CD86) костимулирующие молекулы на подмножествах макрофагов слизистой оболочки при воспалительном заболевании кишечника (ВЗК) человека Clin Exp Immunol. 1997; 110: 104–13. [Бесплатная статья PMC] [PubMed] [Google Scholar] 55. Куаллс Дж. Э., Каплан А. М., ван Ройен Н., Коэн Д. А..Подавление экспериментального колита мононуклеарными фагоцитами кишечника. J Leukoc Biol. 2006; 80: 802–15. [PubMed] [Google Scholar] 56. Макдональд К.П., Палмер Дж. С., Кронау С., Сеппанен Э., Олвер С., Раффельт NC и др. Антитело против рецептора колониестимулирующего фактора 1 истощает резидентную субпопуляцию моноцитов и макрофагов, ассоциированных с тканями и опухолями, но не подавляет воспаление. Кровь. 2010; 116: 3955–63. [PubMed] [Google Scholar] 57. Hontecillas R, Horne WT, Climent M, Guri AJ, Evans C, Zhang Y и др.Иммунорегуляторные механизмы макрофагов PPAR-гамма у мышей с экспериментальным воспалительным заболеванием кишечника. Mucosal Immunol. 2011; 4: 304–13. [Бесплатная статья PMC] [PubMed] [Google Scholar] 58. Kuhn R, Lohler J, Rennick D, Rajewsky K, Muller W. У мышей с дефицитом интерлейкина-10 развивается хронический энтероколит. Клетка. 1993; 75: 263–74. [PubMed] [Google Scholar] 59. Такеда К., Клаусен Б.Е., Кайсё Т., Цудзимура Т., Терада Н., Форстер И. и др. Повышенная активность Th2 и развитие хронического энтероколита у мышей, лишенных Stat3 в макрофагах и нейтрофилах.Иммунитет. 1999; 10: 39–49. [PubMed] [Google Scholar] 60. Иванов И.И., де Фрутос Р.Л., Манель Н., Йошинага К., Рифкин Д.Б., Сартор РБ и др. Специфическая микробиота направляет дифференцировку Т-хелперных клеток, продуцирующих ИЛ-17, в слизистой оболочке тонкой кишки. Клеточный микроб-хозяин. 2008; 4: 337–49. [Бесплатная статья PMC] [PubMed] [Google Scholar] 61. Штраух У.Г., Обермайер Ф., Грюнвальд Н., Гурстер С., Дангер Н., Шульц М. и др. Влияние кишечных бактерий на индукцию регуляторных Т-клеток: уроки модели переноса колита.Кишечник. 2005; 54: 1546–52. [Бесплатная статья PMC] [PubMed] [Google Scholar] 62. Болезнь Брэнда С. Крона: Th2, Th27 или оба? Изменение парадигмы: новые иммунологические и генетические открытия указывают на то, что клетки Th27 участвуют в патогенезе болезни Крона. Кишечник. 2009. 58: 1152–67. [PubMed] [Google Scholar] 63. Aggarwal S, Ghilardi N, Xie MH, de Sauvage FJ, Gurney AL. Интерлейкин-23 способствует определенному состоянию активации CD4 Т-клеток, характеризующемуся продуцированием интерлейкина-17. J Biol Chem. 2003. 278: 1910–4. [PubMed] [Google Scholar] 64.Bettelli E, Carrier Y, Gao W., Korn T., Strom TB, Oukka M и др. Взаимные пути развития для генерации патогенных эффекторных Th27 и регуляторных Т-клеток. Природа. 2006; 441: 235–8. [PubMed] [Google Scholar] 65. Mangan PR, Harrington LE, O’Quinn DB, Helms WS, Bullard DC, Elson CO и др. Трансформирующий фактор роста бета индуцирует развитие линии T (H) 17. Природа. 2006; 441: 231–4. [PubMed] [Google Scholar] 67. Lelouard H, Fallet M, de Bovis B, Meresse S, Gorvel JP. Дендритные клетки Пейера отбирают образцы антигенов, протягивая дендриты через специфичные для М-клеток трансцеллюлярные поры.Гастроэнтерология. 2012; 142: 592–601.e3. [PubMed] [Google Scholar] 68. Rescigno M, Urbano M, Valzasina B, Francolini M, Rotta G, Bonasio R и др. Дендритные клетки экспрессируют белки с плотными контактами и проникают в монослои эпителия кишечника, чтобы взять образцы бактерий. Nat Immunol. 2001; 2: 361–7. [PubMed] [Google Scholar] 69. Coombes JL, Siddiqui KR, Arancibia-Carcamo CV, Hall J, Sun CM, Belkaid Y, et al. Функционально специализированная популяция CD103 + DC слизистой оболочки индуцирует Foxp3 + регуляторные Т-клетки посредством TGF-бета и механизма, зависимого от ретиноевой кислоты.J Exp Med. 2007. 204: 1757–64. [Бесплатная статья PMC] [PubMed] [Google Scholar] 70. Уокер Дж. А., Барлоу Дж. Л., Маккензи А. Н.. Врожденные лимфоидные клетки — как мы их пропустили? Nat Rev Immunol. 2013; 13: 75–87. [PubMed] [Google Scholar] 71. Пирсон Т., Шульц Л.Д., Миллер Д., Кинг М., Ланинг Дж., Фодор В. и др. Мыши, не страдающие ожирением, активирующие диабетическую рекомбинацию ген-1 (NOD-Rag1 null), рецептор интерлейкина (IL) -2, общая гамма-цепь (IL2r gamma null): радиорезистентная модель лимфогематопоэтического приживления человека. Clin Exp Immunol.2008. 154: 270–84. [Бесплатная статья PMC] [PubMed] [Google Scholar] 72. Tait Wojno ED, Artis D. Врожденные лимфоидные клетки: балансировка иммунитета, воспаления и восстановления тканей в кишечнике. Клеточный микроб-хозяин. 2012; 12: 445–57. [Бесплатная статья PMC] [PubMed] [Google Scholar] 73. Зонненберг Г.Ф., Монтичелли Л.А., Аленгхат Т., Фунг Т.С., Хатник Н.А., Кунисава Дж. И др. Врожденные лимфоидные клетки способствуют анатомическому сдерживанию лимфоидно-резидентных комменсальных бактерий. Наука. 2012; 336: 1321–5. [Бесплатная статья PMC] [PubMed] [Google Scholar] 74.Хупер Л.В., Макферсон А.Дж. Иммунные адаптации, поддерживающие гомеостаз кишечной микробиоты. Nat Rev Immunol. 2010. 10: 159–69. [PubMed] [Google Scholar] 75. Пабст О. Новые концепции в создании и функциях IgA. Nat Rev Immunol. 2012; 12: 821–32. [PubMed] [Google Scholar] 76. Фуката М., Шан Л., Сантаолалла Р., Сотолонго Дж., Пасторини С., Испания С. и др. Конститутивная активация эпителиального TLR4 усиливает воспалительные реакции на повреждение слизистой оболочки и приводит к онкогенезу, связанному с колитом.Воспаление кишечника. 2011; 17: 1464–73. [Бесплатная статья PMC] [PubMed] [Google Scholar] 77. Geuking MB, Cahenzli J, Lawson MA, Ng DC, Slack E, Hapfelmeier S и др. Бактериальная колонизация кишечника вызывает мутуалистические регуляторные Т-клеточные ответы. Иммунитет. 2011; 34: 794–806. [PubMed] [Google Scholar] 78. Кларк JA, Callicoat PA, Brenner NA, Bradley CA, Smith DM., Jr. Селективный дефицит IgA у доноров крови. Am J Clin Pathol. 1983; 80: 210–3. [PubMed] [Google Scholar] 79. Mbawuike IN, Pacheco S, Acuna CL, Switzer KC, Zhang Y, Harriman GR.Иммунитет слизистой оболочки к гриппу без IgA: модель мыши с нокаутом IgA. J Immunol. 1999. 162: 2530–7. [PubMed] [Google Scholar] 80. Хупер Л.В., Мидтведт Т., Гордон Дж. Как взаимодействия хозяина и микробов формируют питательную среду кишечника млекопитающих. Анну Рев Нутр. 2002; 22: 283–307. [PubMed] [Google Scholar] 81. Корен О, Спор А, Фелин Дж., Фак Ф, Стомбо Дж., Тремароли В. и др. Микробиота ротовой полости, кишечника и зубного налета человека у пациентов с атеросклерозом. Proc Natl Acad Sci USA. 2011; 108 (Приложение 1): 4592–8.[Бесплатная статья PMC] [PubMed] [Google Scholar] 82. Корен О., Гудрич Дж. К., Каллендер Т. К., Спор А, Лайтинен К., Бэкхед Х. К. и др. Ремоделирование кишечного микробиома и метаболические изменения хозяина во время беременности. Клетка. 2012; 150: 470–80. [Бесплатная статья PMC] [PubMed] [Google Scholar] 83. Wostmann BS, Larkin C, Moriarty A, Bruckner-Kardoss E. Диетическое потребление, энергетический метаболизм и экскреторные потери взрослых самцов стерильных крыс Wistar. Lab Anim Sci. 1983; 33: 46–50. [PubMed] [Google Scholar] 84. Chassaing B, Aitken JD, Gewirtz AT, Vijay-Kumar M.Микробиота кишечника вызывает метаболические заболевания у иммунологически измененных мышей. Adv Immunol. 2012; 116: 93–112. [PubMed] [Google Scholar] 85. Карвалью Ф.А., Эйткен Д.Д., Виджай-Кумар М., Гевиртц А.Т. Взаимодействие Toll-подобных рецепторов с микробиотой кишечника: беспокойство на свой страх и риск! Annu Rev Physiol. 2012; 74: 177–98. [PubMed] [Google Scholar] 86. Вамадеван А.С., Фуката М., Арнольд Е.Т., Томас Л.С., Хсу Д., Абреу М.Т. Регулирование MD-2, связанного с Toll-подобным рецептором 4, в эпителиальных клетках кишечника: всесторонний анализ. Врожденный иммунитет.2010. 16: 93–103. [Бесплатная статья PMC] [PubMed] [Google Scholar] 87. Фурри Э, Макфарлейн С, Томсон Г, Макфарлейн ГТ. Паттерны экспрессии Toll-подобных рецепторов-2, -3 и -4 в толстой кишке человека и их регуляция с помощью бактерий, связанных со слизистой оболочкой. Иммунология. 2005; 115: 565–74. [Бесплатная статья PMC] [PubMed] [Google Scholar] 88. Гевиртц А.Т., Навас Т.А., Лайонс С., Годовски П.Дж., Мадара Дж.Л. Передний край: бактериальный флагеллин активирует базолатерально экспрессируемый TLR5, чтобы вызвать экспрессию эпителиальных провоспалительных генов. J Immunol.2001; 167: 1882–5. [PubMed] [Google Scholar] 89. Гадими Д., Врезе М., Хеллер К. Дж., Шрезенмейр Дж. Влияние природной ДНК комменсального происхождения на сигнальный каскад толл-подобного рецептора 9 (TLR9), экспрессию хемокинового IL-8 и барьерную интеграцию поляризованных эпителиальных клеток кишечника. Воспаление кишечника. 2010. 16: 410–27. [PubMed] [Google Scholar] 90. Вилайсане А, Муруве Д.А. Врожденный иммунный ответ на ДНК. Semin Immunol. 2009; 21: 208–14. [PubMed] [Google Scholar] 91. Бисвас С.К., Лопес-Коллазо Э. Толерантность к эндотоксинам: новые механизмы, молекулы и клиническое значение.Trends Immunol. 2009. 30: 475–87. [PubMed] [Google Scholar] 92. Элинав Э., Тайс, Калифорния, Флавелл РА. Анализ изменений микробиоты у мышей с дефицитом инфламмасом. Методы Мол биол. 2013; 1040: 185–94. [PubMed] [Google Scholar] 93. Хенао-Мехиа Дж., Элинав Э., Джин С., Хао Л., Мехал В.З., Строиг Т. и др. Инфламмасомный дисбиоз регулирует прогрессирование НАЖБП и ожирения. Природа. 2012; 482: 179–85. [Бесплатная статья PMC] [PubMed] [Google Scholar] 95. Ненси А., Беккер С., Вулларт А., Гареус Р., ван Лоо Г., Данезе С. и др.Эпителиальный NEMO связывает врожденный иммунитет с хроническим воспалением кишечника. Природа. 2007; 446: 557–61. [PubMed] [Google Scholar] 96. Ракофф-Нахум С., Паглино Дж., Эслами-Варзане Ф., Эдберг С., Меджитов Р. Распознавание комменсальной микрофлоры толл-подобными рецепторами необходимо для гомеостаза кишечника. Клетка. 2004. 118: 229–41. [PubMed] [Google Scholar] 97. Джонс Р.М., Слоан В.М., Ву Х., Луо Л., Кумар А., Кумар М.В. и др. Введение флагеллина защищает слизистую оболочку кишечника от апоптоза, вызванного облучением, за счет активности MKP-7.Кишечник. 2011; 60: 648–57. [PubMed] [Google Scholar] 98. Пауэлл Н., Уокер А. В., Столарчик Е., Канаван Дж. Б., Гокмен М. Р., Маркс Е. и др. Фактор транскрипции T-bet регулирует воспаление кишечника, опосредованное рецептором интерлейкина-7 + врожденными лимфоидными клетками. Иммунитет. 2012; 37: 674–84. [Бесплатная статья PMC] [PubMed] [Google Scholar] 99. Гарретт WS, лорд GM, Punit S, Lugo-Villarino G, Mazmanian SK, Ito S, et al. Инфекционный язвенный колит, вызванный дефицитом T-bet во врожденной иммунной системе. Клетка. 2007; 131: 33–45.[Бесплатная статья PMC] [PubMed] [Google Scholar] 100. Neufert C, Pickert G, Zheng Y, Wittkopf N, Warntjen M, Nikolaev A, et al. Активация эпителиального STAT3 регулирует гомеостаз кишечника. Клеточный цикл. 2010; 9: 652–5. [PubMed] [Google Scholar] 101. Пикерт Г., Нойферт С., Леппкес М., Чжэн Ю., Витткопф Н., Варнтьен М. и др. STAT3 связывает передачу сигналов IL-22 в эпителиальных клетках кишечника с заживлением ран слизистой оболочки. J Exp Med. 2009; 206: 1465–72. [Бесплатная статья PMC] [PubMed] [Google Scholar] 102. Smith PM, Howitt MR, Panikov N, Michaud M, Gallini CA, Bohlooly YM, et al.Микробные метаболиты, короткоцепочечные жирные кислоты, регулируют гомеостаз Treg-клеток толстой кишки. Наука. 2013; 341: 569–73. [Бесплатная статья PMC] [PubMed] [Google Scholar] 103. Arpaia N, Campbell C, Fan X, Dikiy S, van der Veeken J, Deroos P и др. Метаболиты, продуцируемые комменсальными бактериями, способствуют образованию периферических регуляторных Т-клеток. Природа. 2013; 504: 451–5. [Бесплатная статья PMC] [PubMed] [Google Scholar] 104. Маркос Л.А., Готуццо Э. Кишечные простейшие инфекции у хозяина с ослабленным иммунитетом. Curr Opin Infect Dis.2013; 26: 295–301. [PubMed] [Google Scholar] 105. Raetz M, Hwang SH, Wilhelm CL, Kirkland D, Benson A, Sturge CR и др. Индуцированные паразитами клетки Th2 и дисбактериоз кишечника взаимодействуют в ИФН-гамма-зависимой элиминации клеток Панета. Nat Immunol. 2013; 14: 136–42. [Бесплатная статья PMC] [PubMed] [Google Scholar] 106. Devkota S, Wang Y, Musch MW, Leone V, Fehlner-Peach H, Nadimpalli A и др. Таурохолевая кислота, индуцированная пищевым жиром, способствует размножению патобионтов и колиту у мышей Il10 — / -. Природа. 2012; 487: 104–8.[Бесплатная статья PMC] [PubMed] [Google Scholar] 107. Юнкер Ю., Цейссиг С., Ким С.Дж., Барисани Д., Визер Х., Леффлер Д.А. и др. Ингибиторы трипсина амилазы пшеницы вызывают воспаление кишечника за счет активации толл-подобного рецептора 4. J Exp Med. 2012; 209: 2395–408. [Бесплатная статья PMC] [PubMed] [Google Scholar] 108. Соммер Ф., Бакхед Ф. Мастера кишечной микробиоты, отвечающие за развитие и физиологию хозяина. Nat Rev Microbiol. 2013; 11: 227–38. [PubMed] [Google Scholar]

    Иммунитет кишечника млекопитающих

    Biomed J. Автор рукописи; доступно в PMC 2016 15 января.

    Опубликован в окончательной отредактированной форме как:

    PMCID: PMC4714863

    NIHMSID: NIHMS609345

    Benoit Chassaing

    1 Центр воспаления, иммунитета и инфекции штата Джорджия, Институт биологических наук штата Джорджия , США

    Маниш Кумар

    2 Департамент диетологии, Государственный университет Пенсильвании, Юниверсити-Парк, штат Пенсильвания, США

    Марк Т. Бейкер

    3 Биологический факультет Университета штата Джорджия, Атланта, Джорджия, США

    Вишал Сингх

    2 Департамент диетологии, Государственный университет Пенсильвании, Юниверсити Парк, Пенсильвания, США

    Матам Виджай-Кумар

    2 Департамент диетологии Университета штата Пенсильвания, Юниверсити Парк, Пенсильвания, США

    4 Медицинский факультет Медицинского колледжа Пенсильванского государственного университета, Hers Эй, штат Пенсильвания, США

    1 Центр воспаления, иммунитета и инфекций, Институт биомедицинских наук, Университет штата Джорджия, Атланта, Джорджия, США

    2 Департамент диетологии, Университет штата Пенсильвания, Университетский парк, Пенсильвания, США

    3 Биологический факультет Университета штата Джорджия, Атланта, Джорджия, США

    4 Медицинский факультет Медицинского колледжа Университета Пенсильвании, Херши, штат Пенсильвания, США

    Для корреспонденции: Др.Матам Виджай-Кумар, Департамент диетологии, Государственный университет Пенсильвании, Пенсильвания, США. 323, лаборатория Чандли, Юниверсити-Парк, Пенсильвания 16802, США. Тел: 814-8652786; Факс: 814-8636103; [email protected] См. другие статьи в PMC, в которых цитируется опубликованная статья.

    Abstract

    Кишечник млекопитающих является крупнейшим иммунным органом в организме и состоит из клеток негемопоэтического (эпителий, клетки Панета, бокаловидные клетки) и гемопоэтического (макрофаги, дендритные клетки, Т-клетки) происхождения, а также жилище для триллионов микробов, известных под общим названием микробиота.Гомеостаз этой большой микробной биомассы является необходимым условием для поддержания здоровья хозяина за счет максимизации благоприятных симбиотических отношений и сведения к минимуму рисков проживания в такой непосредственной близости. И микробиота, и иммунная система хозяина взаимодействуют друг с другом для взаимного поддержания гомеостаза в том, что можно назвать «отношениями любви и ненависти». Кроме того, врожденное и адаптивное иммунные ответвления иммунной системы хозяина взаимодействуют и компенсируют друг друга для поддержания равновесия в очень сложной экосистеме кишечника стабильным и строгим образом.Любой дисбаланс из-за врожденного или адаптивного иммунодефицита или аберрантного иммунного ответа может привести к дисбактериозу и слабому или сильному воспалению кишечника, что в конечном итоге приведет к метаболическим заболеваниям.

    Ключевые слова: врожденный иммунитет, микробиота, NOD-подобные рецепторы, рецепторы распознавания образов, толл-подобные рецепторы

    В кишечнике млекопитающих обитает большое количество бактерий, особенно в дистальном отделе кишечника, известных под общим названием микробиота. В последнее десятилетие всплеск исследований, описывающих важность кишечной микробиоты для здоровья и болезней хозяина, убедительно продемонстрировал, что колонизация разнообразной и стабильной микробиотой абсолютно необходима для правильного развития как врожденных, так и адаптивных ветвей иммунной системы.

    Большое количество недавних исследований показывает, что метаболические функции микробиоты существенны и сопоставимы по величине с функциями печени. Микробиота может, например, влиять на состав жирных кислот сетчатки и хрусталика глаза, влиять на плотность костей и способствовать васкуляризации кишечника. [1] Этот биореактор обеспечивает необходимые питательные вещества, такие как биотин и витамин К, и переваривает сложные пищевые волокна, образуя масляную кислоту, главный источник топлива для эпителия кишечника. [2] Эоны совместной эволюции, движимые общим интересом, сделали микробиоту партнером иммунной системы в борьбе с бактериальными патогенами. В частности, микробиота действует как устойчивый конкурент за пищу, пространство и места закрепления, тем самым исключая вторжение энтеропатогенов (устойчивость к колонизации). Напротив, два недавних исследования показывают, что микробиота способствует успешной передаче патогенных вирусов, [3,4] и множественные мышиные модели воспалительных заболеваний, от колита до артрита, требуют микробиоты кишечника.Кроме того, то, что состав микробиоты является определяющим фактором серьезности заболевания, указывает на то, что микробиота также может представлять серьезную угрозу для своего хозяина.

    Поддержание гомеостаза такой сложной экосистемы потребовало разработки специализированной «иммунной системы слизистой оболочки» (MIS), которая целесообразно обнаруживает и устраняет преходящие патогены, одновременно удерживая полезных условно-патогенных микроорганизмов на правильной стороне монослоя эпителия кишечника. Другими словами, существует постоянное взаимодействие между эпителием и микробиотой, так что эпителий хорошо подготовлен к ответу на любое вторжение благодаря своей способности секретировать множество хемоаттрактантов иммунных клеток (аналогично « To to make peace,». готовиться к войне »).Поскольку это должно быть сделано при минимизации вреда для полезных микробов и тканей хозяина, MIS разработала сложную систему связи с микробиотой, в значительной степени опосредованную toll-подобным рецептором (TLR) и распознаванием паттернов рецепторов, подобных домену олигомеризации нуклеотидов (NLR). рецепторы (PRR). Похоже, что как врожденная, так и адаптивная иммунные системы эволюционировали так, чтобы для их правильного развития требовались микробные взаимодействия, [5–7] , как схематично представлено на. Подтверждая это мнение, у стерильных мышей наблюдается пониженный уровень секреторного иммуноглобулина А в кишечнике (sIgA), дефекты развития лимфоидной ткани, ассоциированной с кишечником, а также более мелкие пейеровские бляшки и мезентериальные лимфатические узлы. [8] В этом обзоре мы описываем последние достижения в области MIS млекопитающих, уделяя особое внимание взаимодействию между клетками врожденного и адаптивного иммунитета и их эффекторными молекулами в гомеостазе микробиоты, поддержании толерантности и установлении соответствующего воспалительного / воспалительного процесса. иммунный ответ против возбудителя инсульта / вторжения.

    Иммунная система слизистой оболочки кишечника. В нормальном состоянии взаимодействия PRR и микробиоты приводят к секреции антимикробных пептидов и развитию лимфоидной ткани, ассоциированной с кишечником (GALT).Перекрестное взаимодействие между микробиотой и кишечной иммунной системой вызывает гомеостатические факторы, такие как IgA и дефенсины, которые поддерживают гомеостаз микробиоты и целостность эпителиального барьера.

    Физические и химические барьеры в кишечнике

    Кишечник млекопитающих является основным местом взаимодействия между иммунной системой хозяина и содержимым просвета, включая не только пищевые антигены и токсины, но и микробиоту. [9] Иммунитет слизистой оболочки начинается в эпителии, когда микробы сталкиваются с хозяином на поверхности эпителия слизистой оболочки, пытаясь колонизировать и закрепиться.Большинство этих микробов и их метаболитов исключены из внутреннего доступа к хозяину как физическими, так и химическими барьерами. Физические барьеры включают один слой эпителиальных клеток, их межклеточные плотные соединения и слизь, покрывающую эпителиальную поверхность. [9] Кроме того, физический барьер хорошо поддерживается тонким балансом химических барьеров, таких как кислотность (низкий pH), детергенты (соли желчных кислот), протеолитические ферменты (трипсин), ферменты, разрушающие клеточные стенки (лизоцим) и антибактериальные свойства. белки (дефенсины и др.), которые контролируют микробную популяцию. Кроме того, однонаправленные перистальтические движения кишечника также помогают предотвратить проникновение микробов из плотного дистального содержимого кишечника в тонкий кишечник.

    Слой слизи: смазывающий и улавливающий барьер

    Слой слизи, покрывающий эпителиальные поверхности, смазывает кишечный тракт. Он демонстрирует липкую гелеобразующую способность из-за своей жесткой белковой структуры и высокой когезии. Слизь может рассматриваться как первая линия физической защиты кишечника от микробных патогенов, помогающая улавливать беспокоящий микроб. [10,11] Муцины, основные компоненты слизистого слоя, секретируются бокаловидными клетками, которые разбросаны среди энтероцитов по всему эпителию. Муцины представляют собой высокомолекулярные (MW) гликопротеины с обширным гликозилированием и сахарными фрагментами, присоединенными к остаткам серина или треонина O -гликозидными связями. Изменения в составе муцина могут лежать в основе этиологии некоторых заболеваний, таких как язвенный колит и гастрит, вызванный Helicobacter pylori . [12]

    В настоящее время хорошо известно, что муцины также играют более непосредственную роль в борьбе с патогенами и паразитами, играя важную роль в скоординированном иммунном ответе на инфекцию. [13,14] Они также служат местом прикрепления микроорганизмов за счет взаимодействия между многими бактериальными компонентами. Однако сверхэкспрессия некоторых белков муцина приводит к раку, [15] , в то время как дефицит приводит к воспалению кишечника и колиту (MUC-2). [16] В последнее время бокаловидные клетки также участвуют в обеспечении оральной толерантности. [17] Это исследование показывает, что в устойчивом состоянии бокаловидные клетки тонкого кишечника функционируют как каналы, доставляющие растворимые антигены с низкой молекулярной массой из просвета кишечника в лежащие в основе иммунные клетки [дендритные клетки CD103 + lamina propria (DC)].Эта преимущественная доставка антигенов к DC с толерогенными свойствами подразумевает ключевую роль бокаловидных клеток в гомеостазе кишечника. [17] Недавно было показано, что у мышей с дефицитом специфической синтазы жирных кислот толстого эпителия (FAS), неспособных ацилировать MUC-2 пальмитиновой кислотой ( S -пальмитоилирование), что приводит к нарушению секреции и функции, проявляются нарушения в слизистом барьере кишечника, а также повышенная кишечная проницаемость, колит, системное воспаление и изменения микробной экологии кишечника. [18]

    Эпителиальный барьер: функция «хранителя ворот»

    Желудочно-кишечный эпителий образует критически важный интерфейс между внутренним хозяином и содержимым просвета. Большинство эпителиев представляют собой абсорбирующие клетки (энтероциты), которые также должны поддерживать параклеточный и трансклеточный транспорт питательных веществ, электролитов и воды. Энтероциты являются одними из наиболее быстро регенерирующих клеток в организме, которым соответствует высокая скорость апоптоза, позволяющая поддерживать гомеостаз эпителиальных клеток и позволяя эпителию быстро заживать после повреждения. [19,20] Барьер, образованный эпителием, поэтому должен быть строго регулируемым и избирательно проницаемым. Стабильность и функция эпителиального барьера зависит от комплекса белков, состоящих из различных межклеточных соединений, которые включают плотные соединения (окклюдная зона и клаудины), адгезивные соединения (E-кадгерин и β-катенин) и десмосомы. [21] Соответственно, проницаемость для различных питательных веществ варьируется на отдельных участках и проявляет региональные различия в конкретных транспортируемых питательных веществах и ионах.Эпителии также оснащены многочисленными насосами, которые помогают поддерживать однонаправленные / векторные молекулы секреции. Интересно, что у мышей с дефицитом насоса с множественной лекарственной устойчивостью 1 (MDR1), участвующего в перекачивании нескольких биологических молекул, развивается спонтанное воспаление кишечника, подобное воспалительному заболеванию кишечника человека (ВЗК), которое можно предотвратить с помощью лечения антибиотиками. [22,23]

    Прямая врожденная иммунная активность эпителия кишечника

    Известно, что эпителий не только является физическим барьером для микробов и содержимого просвета, но и секретирует различные молекулы, которые помогают поддерживать гомеостаз кишечника.Другими словами, кишечный эпителий можно рассматривать как «дополнительные клетки» MIS. Эпителии секретируют обширную группу цитокинов и хемокинов, которые регулируют хемотаксис иммунных клеток, таких как нейтрофилы, макрофаги, базофилы и Т-клетки. [24] Список эффекторных молекул, специфичных для эпителия, значительно расширяется благодаря развитию микроматриц и других чувствительных аналитических методов, в том числе технологии стерилизации микробов и Cre-рекомбиназы, а также химер костного мозга.Секреция цитокинов эпителиальными клетками кишечника (IEC) наблюдалась во множестве клеточных линий со значительным перекрытием цитокинов, секретируемых иммунными клетками. Даже если их секреция цитокинов меньше, чем секреция иммунных клеток (например, макрофагов), тот факт, что IEC являются наиболее многочисленными клетками на поверхности слизистой оболочки, предполагает, что их уровень секреции оказывает важное влияние на локальные концентрации цитокинов. Однако относительный вклад цитокинов IEC четко не выявлен.

    IEC секретируют ряд хемотаксических цитокинов (хемокинов), которые направляют хемотаксис и, таким образом, контролируют популяции слизистых оболочек как врожденных, так и адаптивных иммунных клеток. Хемокин эпителиального происхождения интерлейкин-8 (IL-8, CXCL8; эквивалент мышиный хемокин, полученный из кератиноцитов, KC) [25] и хемоаттрактанты эпителиальных нейтрофилов, включая аттрактант эпителиальных нейтрофилов-78 (ENA-78, CXCL5), [26 ] Gro-a (CXCL1) и Gro-b (CXCL2), [27] регулируют хемотаксис нейтрофилов.Например, секреция ENA-78 значительно задерживается, но длится дольше, чем секреция IL-8, что позволяет предположить особую роль этих хемокинов в ответе на патогены или воспалительные стимулы. Хемокины, секретируемые эпителием, включая хемотаксический белок моноцитов (MCP-1; CCL2), воспалительный белок макрофагов (MIP1α; CCL3) и RANTES / CC L5 (регулируемый при активации и предположительно секретируемый), в первую очередь регулируют рекрутирование моноцитов. MIP1α, по-видимому, играет важную роль в рекрутировании DC слизистой оболочки. [27]

    IEC также секретирует хемокины, которые стимулируют набор различных субпопуляций Т-клеток в слизистую оболочку. Эти хемокины имеют решающее значение для управления рекрутингом интраэпителиальных лимфоцитов (IEL) и включают индуцируемый интерфероном белок (IP-10), монокин, индуцированный интерфероном (IFN) -γ (Mig), и IFN-индуцируемый α-хемоаттрактант Т-клеток (I -TAC). [28] В отличие от нейтрофилов, IEL слизистой оболочки обычно присутствуют в слизистой оболочке, что согласуется с наблюдением, что хемоаттрактанты Т-клеток экспрессируются конститутивно. [29]

    Помимо организации набора различных иммунных клеток, IEC также секретируют ряд провоспалительных цитокинов, лучшими примерами которых являются фактор некроза опухоли (TNF) -α и IL-6. [30,31] Секреция этих цитокинов влияет на местное воспалительное состояние, а также оказывает существенное влияние на системные уровни цитокинов. Например, TNF-α является не только мощным усилителем других провоспалительных цитокинов и хемокинов, но также заставляет IEC производить провоспалительные ферменты, индуцируемые синтазой оксида азота (iNOS) и циклооксигеназой-2 (COX-2), и активирует нейтрофилы для генерации большего количества активные формы кислорода (АФК) и дегрануляция при встрече с патогенными раздражителями.Врожденная иммунная активность этих IEC в сотрудничестве с профессиональными иммунными клетками может оказывать существенное влияние как на микробиоту, так и на гомеостаз ткани хозяина.

    Помимо растворимых иммуномодуляторов, IEC также регулируют множество молекул адгезии, которые влияют на взаимодействие эпителия с инфильтрирующими иммунными клетками. Считается, что экспрессия лигандов нейтрофилов в IEC играет важную роль в регуляции адгезии и трансэпителиальной миграции (диапедез) нейтрофилов.В частности, была продемонстрирована ключевая роль эпителиального CD47 и сигнального регуляторного белка (SIRP) 1a в регуляции трансмиграции нейтрофилов. [32,33] Молекула внутриклеточной адгезии 1 (ICAM-1) заметно активируется при воспалительных состояниях и, возможно, играет роль в повышении адгезии нейтрофилов к эпителию, связанной с ВЗК. [34]

    IEC также известны как секретирующие растворимые рецепторы, которые могут нейтрализовать биоактивность провоспалительных цитокинов.Например, активация инфламмасом приводит к секреции мощных провоспалительных цитокинов IL-1β и IL-18. Биологическая активность цитокинов инфламмасом тонко регулируется экспрессией эндогенных, конститутивно экспрессируемых растворимых белков-ингибиторов. Действительно, отсутствие этих антицитокинов приводит к неконтролируемому воспалению, которое вызывает повреждение тканей хозяина. [35] Хорошо изученным примером регуляции цитокинов инфламмасом является секреторный антагонист рецептора IL-1 (sIL-1Ra), который конкурирует с IL-1β за свой рецептор, тем самым ослабляя биоактивность этого мощного провоспалительного цитокина.Экспрессия IEC sIL-1Ra может быть индуцирована провоспалительными стимулами, такими как сам IL-1β и липополисахарид (LPS), а также различными иммуномодуляторами, такими как гранулоцитарно-макрофагальный колониестимулирующий фактор (GM-CSF), IFN-β. , IFN-γ и флагеллин. [36–38] Важно отметить, что sIL-1Ra экспрессируется гораздо шире, чем IL-1β, что позволяет клеткам, которые не производят IL-1β, играть роль в регуляции его активности. Точно так же эпителий может индуцировать IL-18-связывающий белок (IL-18BP) в ответ на провоспалительный цитокин IFN-γ, который является мощным ингибитором IL-18. [38]

    Ключевым аспектом роли эпителия в MIS является его способность тонко регулировать функцию и активацию иммунных клеток. Следовательно, активация и возврат в нормальное состояние должны быть тесно связаны. Например, неспособность быстро набирать иммунные клетки в ответ на патогены может сделать хозяина более восприимчивым к системной инфекции (например, мышей с дефицитом MyD88, обсуждаемых ниже). И наоборот, чрезмерное и неконтролируемое рекрутирование, особенно нейтрофилов, вероятно, будет пагубным, поскольку оно может привести к значительному повреждению ткани хозяина, как это наблюдается при хронической ВЗК.Таким образом, IEC осуществляют жесткий контроль над своими иммуномодулирующими генами MIS, особенно связанными с рекрутированием иммунных клеток, такими как нейтрофильный хемоаттрактант IL-8.

    Микроскладчатые клетки

    Другой структурно отличающийся тип эпителиальных клеток — это клетки микроскладок (М), характеризующиеся микроскладкой плазматической мембраной. Эти клетки являются иммунологическими дозорами, играющими важную роль в адаптивном иммунитете слизистых оболочек. [39] Они считаются специализированным эпителием и присутствуют на поверхности В-клеточных фолликулов [пятна Пейера и изолированные лимфоидные фолликулы (ILF)].Это основные клетки, отвечающие за отбор проб кишечной микробиоты и патогенов. [40] Структурно М-клетки имеют более короткие / скудные микроворсинки и гораздо меньше гликокаликса на своей поверхности, в отличие от других энтероцитов, которые помогают им собирать частицы из просвета и направлять их в лимфоидные ткани на своей базолатеральной стороне. Благодаря этой природе эти клетки стали центральным звеном в разработке оральных вакцин. [41] Однако они также являются одними из наиболее используемых типов клеток в просвете некоторых патогенов (например,грамм. Salmonella typhimurium, Yersinia spp, адгезивно-инвазивный Escherichia coli, реовирусов) для облегчения их инвазии. [42–44] Недавно появились сообщения о «ворсинчатых» М-клетках, которые присутствуют на ворсинчатом эпителии тонкой кишки и имеют общие функциональные и структурные характеристики с нормальными М-клетками, но лишены какой-либо лимфоидной ассоциации. [45]

    Клетки Панета

    Еще одним важным компонентом MIS являются «клетки Панета», названные в честь Джозефа Панета.Эти столбчатые клетки имеют выступающие гранулы и располагаются в основании крипт Либеркюн в тонкой кишке. Каждая крипта содержит примерно 15 стволовых клеток и 10 клеток Панета. Иногда клетки Панета также присутствуют в желудке и толстой кишке в качестве метапластической реакции на воспаление кишечника. В отличие от IECs, продолжительность жизни которых составляет 3-5 дней, клетки Панета живут относительно дольше (> 30 дней). Эти клетки имеют большие апикальные секреторные гранулы, богатые дефенсином, которые высвобождаются в узкие эпителиальные крипты посредством экзоцитоза (т.е.е. мерокринная секреция) в ответ на различные стимулы, которые включают продукты бактерий, но не продукты грибов или простейших. Клетки Панета человека экспрессируют два альфа-дефенсина: дефенсин 5 человека (HD5) и дефенсин 6 человека (HD6). [46] Они также секретируют лизоцим, секреторную фосфолипазу A2 и регенерирующий островковый белок III-альфа (RegIIIA). [47] Однако, в отличие от людей, мыши и крысы экспрессируют более двух альфа-дефенсинов. Клетки Панета мыши также секретируют многочисленные пептиды, связанные с криптдином, и РНКазу, ангиогенин 4 (для получения дополнительной информации см.[ 47 ]). Дефенсины синтезируются в виде препропептидов, которые в конечном итоге процессируются трипсином клеток Панета у людей и матриксной металлопротеиназой-7 (MMP-7) у мышей. [48] Данные экспериментальных животных показывают, что дефенсины составляют около 15% от общей антимикробной активности кишечника как у стерильных, так и у обычных мышей [49] , а концентрация дефенсинов в криптах может достигать> 10 мг. / мл. [50]

    Кишечные макрофаги

    Макрофаги (MΦ) — одни из самых распространенных лейкоцитов в собственной субэпителиальной пластинке млекопитающих, и эта популяция, вероятно, составляет самый большой резервуар макрофагов в организме.Количество MΦ в различных участках кишечника, по-видимому, тесно связано с относительной микробиологической нагрузкой, и, таким образом, они наиболее высоки в толстом кишечнике и наименьшие — в кишечнике мышей, свободных от микробов. Учитывая, что ВЗК, как полагают, вызывается аберрантным иммунным ответом на комменсальную микробиоту, которая присутствует в больших количествах в нормальной толстой кишке, и что MΦ присутствуют там постоянно, интересно подумать, почему кишечник не находится в постоянном состоянии воспаление. [51] В многочисленных исследованиях было показано, что в отличие от MΦ из других тканей, MΦ слизистой оболочки не отвечает на лиганды TLR, секретируя провоспалительные цитокины или хемокины, такие как IL-12, IL-23, TNF-α, IL-1. , IL-6 или CXCL10 (IP-10), они также не активируют костимуляторные молекулы и не генерируют продукцию ROS и оксида азота (NO) в этих условиях. [51] Однако они синтезируют IL-10 (основной противовоспалительный цитокин) конститутивно или в ответ на лиганды TLR. [52,53] Кроме того, резидентные МФ кишечника обладают высокой фагоцитарностью и экспрессируют CD36, рецептор, который способствует фагоцитозу апоптотических клеток. [51] Они также проявляют сильную бактерицидную активность, не вызывая явного воспаления, позволяя локальному MΦ действовать как брандмауэр против любых комменсальных бактерий, которые нарушают эпителиальный барьер. Они не экспрессируют высокие уровни костимулирующих молекул, таких как CD80, CD86 или CD40, но они экспрессируют цитозольные PRR, которые имеют решающее значение для их антибактериальной активности. [54] Кроме того, резидентные МФ кишечника не только вносят вклад в гомеостаз кишечника, действуя в качестве единицы утилизации отходов для местных бактерий и мертвых клеток, но также активно регулируют целостность эпителия. В результате истощение резидентного MΦ увеличивает восприимчивость мышей к экспериментально индуцированному колиту. [55,56] Экспрессия фактора транскрипции рецептора-γ, активируемого пролифератором пероксисом (PPAR-γ), посредством MΦ слизистой оболочки является альтернативным механизмом, с помощью которого они могут предотвращать локальное воспаление за счет его способности подавлять экспрессию провоспалительных генов. [57] Таким образом, MΦ в MIS можно рассматривать как функциональную подгруппу, участвующую в нормальных физиологических процессах ремоделирования ткани и избегая иммунного ответа на комменсальные микробы.

    Накопленные данные показывают, что большинство иммунных клеток в MIS способны к конститутивной секреции IL-10. Стоит отметить, что удаление IL-10 приводит к развитию спонтанного колита. [58] Кроме того, ингибирование передачи сигналов IL-10 в миелоидных клетках посредством целенаправленной делеции преобразователя сигнала и активатора транскрипции 3 (STAT3) приводит к спонтанному колиту. [59] Очевидно, что IL-10 является критическим физиологическим медиатором инерции МФ кишечника. Важный вопрос, который еще не решен, заключается в том, отражает ли измененное поведение MΦ, которое происходит во время воспаления, изменения в обычно инертном резидентном MΦ или является результатом проникновения нового, высокочувствительного профессионального MΦ. Существующие данные подтверждают последнюю идею, но неясно, принадлежат ли эти недавно прибывшие MΦ к отдельной линии от резидентного MΦ. Несколько линий доказательств указывают на то, что воспалительные MΦ происходят из недавно набранной популяции, которая происходит из циркулирующих моноцитов Ly6C hi .

    Кишечные Т-лимфоциты

    Т-клетки являются одними из наиболее распространенных лейкоцитов в субэпителиальной пластинке и играют важную роль в иммунитете кишечника млекопитающих, что подчеркивается драматическими последствиями их отсутствия, такими как инфекция вируса иммунодефицита человека (ВИЧ). Свободная от зародышей мышиная пластинка лишена Т-клеток, только первичные фолликулы в пятнах Пейера. [60,61] После колонизации бактериями популяция Т-клеток слизистой оболочки быстро увеличивается до нормального уровня, как у обычных мышей, демонстрируя, что микробные антигены или продукты необходимы для поддержания популяции Т-клеток.В целом, популяция Т-клеток у здоровых животных в основном состоит из Т-хелперных клеток 1 типа (Th2) и Т-хелперов 2 типа (Th3). В то время как болезнь Крона связана с профилем цитокинов Th2, язвенный колит имеет тенденцию к Th3. [62] Эта концепция была дополнительно усложнена описанием толеризующих регуляторных Т-клеток (Tregs) и провоспалительных клеток Th27, новой популяции Т-клеток, характеризующейся основным фактором транскрипции, связанным с RAR, орфанным рецептором гамма (ROPγt). и поверхностные маркеры IL23R и CC-хемокиновый рецептор типа 6 (CCR6). [62] Клетки Th27 дифференцируются под влиянием IL1β, IL6, IL21, IL23 и трансформирующего фактора роста бета (TGF) -β. [63–65] Клетки Th27, как известно, секретируют провоспалительные цитокины IL17A, IL17F, IL21, IL22 и IL26, а также хемокин CCL20, и несколько исследований продемонстрировали важную роль клеток Th27 в воспалении кишечника, особенно при болезни Крона. [62] Клетки Th27 играют центральную роль в нейтрализации патогенов и комменсальной микробиоты как за счет координации притока нейтрофилов, так и за счет поддержания или восстановления целостности эпителиального барьера посредством синтеза IL17 и IL22.Интересно, что эпителий слизистой оболочки экспрессирует рецепторы для этих цитокинов Th27, способствуя образованию плотных контактов, продукции антимикробных пептидов, а также выработке слизи.

    Кишечные ДК

    ДК являются наиболее мощными профессиональными антигенпрезентирующими клетками (АПК). В отличие от макрофагов, ДК могут инициировать первичный иммунный ответ, активируя наивные Т-клетки, и регулировать провоспалительные или толерогенные иммунные ответы. [66] Кроме того, DC также экспрессируют PRR для определения микробных продуктов в зависимости от окружающей среды.ДК очень гибкие и способны поляризовать иммунные ответы Th2, Th3 или Treg в зависимости от их предшествующего воздействия цитокинов / микробных лигандов. Как только DCs мигрируют в подслизистую оболочку, они становятся высокоэффективными при взятии проб содержимого кишечника через дендриты для захвата и обработки антигена [66] , происходящего через эпителиальный монослой или М-клетки. [67,68] В физиологических условиях DC играют регулирующую роль и предотвращают иммунные ответы против пищевых антигенов и микробиоты кишечника. [66] Они достигают регуляторного профиля с помощью различных сигналов [стромальный лимфопоэтин тимуса (TSLP), IL-10, TGF-β], в частности ретиноевой кислотой (RA), активной формой витамина A. В присутствии RA, кишечные DC (но не DC в других тканях) приобретают способность генерировать Treg и IgA-секретирующие B-клетки с использованием ферментов, которые превращают витамин A в RA. [69] Кишечные ДК можно отличить от ДК других тканей по (i) пониженной экспрессии PRR, (ii) пониженной экспрессии костимулирующих молекул и, таким образом, пониженной презентации антигена, (iii) более высокой продукции противовоспалительных цитокины (IL-10), (iv) способствующие дифференцировке антиген-специфических Treg и секреторных B-клеток IgA, и (v) индукция иммунной толерантности посредством экспрессии маркеров хоминга в кишечнике как в Treg, так и в IgA-секретирующих B-клетках.Любые изменения перечисленных выше характерных особенностей кишечных ДК приводят к аберрантному иммунному ответу на микробиоту, что, возможно, приводит к ВЗК.

    Врожденные лимфоидные клетки

    Врожденные лимфоидные клетки (ILC) — это недавно обнаруженные клетки врожденного иммунитета в MIS [70,71] , которые определяются отсутствием специфических рецепторов антигена и играют центральную роль в регуляции целостность барьера эпителиальных клеток кишечника, а также иммунитет, воспаление и восстановление тканей в кишечнике. [72] Истощение ILC с использованием модели мышей, не страдающих ожирением, гена-1, активирующего диабетическую рекомбинацию (NOD-Rag1 null), у мышей с двойным дефицитом общей гамма-цепи рецептора IL-2 [71] приводит к периферическому распространению комменсального бактерии и системное воспаление, которое было устранено введением IL-22, что позволяет предположить, что IL-22, продуцируемый этими клетками, играет ключевую роль в поддержании барьерной функции. [73]

    Секреторный IgA

    Самым распространенным адаптивным иммунным фактором в просвете кишечника является sIgA, который играет важную роль в гомеостазе кишечника.Он в основном секретируется в виде димера и ковалентно связан с секреторным компонентом эпителиального гликопротеина. Субэпителиальные B-клетки в кишечнике секретируют IgA, который перемещается через монослой эпителия и чья последующая секреция в просвет кишечника представляет собой главный иммунологический барьер. [74] Основные функции sIgA включают (i) защиту от энтеропатогенов (например, Salmonella, ротавирус), (ii) обеспечение коллективного иммунитета против горизонтального фекально-орального распространения энтеропатогенов и (iii) ограничение распространения кишечных инфекций. -производные антигены в кровоток (см. [75] для подробностей). Люминальный sIgA играет важную роль в защите от Vibrio cholera и энтеротоксигенной E. coli. Кроме того, микробиота хозяина играет ключевую роль в секреции IgA, поскольку давно известно, что мыши-гнотобиоты обнаруживают поразительно пониженные уровни sIgA в фекалиях.

    IEC, которые находятся в непосредственной близости с микробиотой, играют роль в процессе секреции IgA. Лучшим примером является то, что развитие ILF из криптопатчей зависит от восприятия микробиоты нуклеотид-связывающим белком 1 домена олигомеризации (NOD1), что приводит к секреции хемоаттрактанта B-клеток CCL20 посредством IEC.ILF являются преобладающими сайтами продукции sIgA независимо от Т-клеток. Воспаление кишечника значительно увеличивает секрецию sIgA в просвет. Например, у мышей, экспрессирующих конститутивно активную форму TLR-4, отсутствовал спонтанный колит, но наблюдалось увеличение рекрутирования В-клеток и продукции трофических факторов, что приводило к увеличению продукции sIgA. [76] Было показано, что в дополнение к влиянию на рекрутирование B-клеток, IECs конститутивно продуцируют факторы, которые напрямую стимулируют продукцию IgA посредством продукции IL-6, и индуцируют B-клеточный IgA 2 переключение классов посредством стимуляции пролиферации -индуцирующий лиганд (APRIL).Передача сигналов врожденного иммунитета через TLR также увеличивает транзит sIgA в просвет, поскольку воздействие на IECs LPS или инактивированных нагреванием E. coli приводит к повышенной экспрессии полимерного рецептора Ig, который связывается с субэпителиальным IgA и перемещает его через эпителий. . Несмотря на то, что несколько исследований показывают, что ДК, взявшие образцы просветных антигенов, являются движущей силой секреции sIgA, эпителий, подвергшийся воздействию микробов, также может влиять на этот процесс, что еще больше подчеркивает важность IEC в MIS.Tregs также играют роль в индукции sIgA, и индукция Treg совпадает с мощной индукцией sIgA [77] при колонизации микробиоты. И люди, и мыши, у которых выборочно отсутствует IgA, проявляют слабые симптомы, поскольку IgM может компенсировать дефицит IgA. [78,79]

    Микробиота способствует развитию хозяина MIS

    Кишечник млекопитающих населен большим разнообразным сообществом микробов, которые вместе известны как кишечная микробиота; он содержит примерно 10 14 бактерий массой 1-2 кг и включает 6-10 основных типов и около 3000 видов. [80] Считается, что состав микробиоты остается стабильным на протяжении всей жизни хозяина, даже при резких изменениях в диете и уровне физической активности, во время беременности и при использовании антибиотиков широкого спектра действия. [81,82]

    Интересно, что «стерильные» (также называемые гнотобиотиками) мыши, лишенные микробиоты, имеют значительные иммунные и метаболические дефекты. [83] Однако накопленные данные на различных моделях мышей с иммунодефицитом показывают, что измененная микробиота играет центральную роль в возникновении воспаления кишечника и метаболических заболеваний. [84] Вместе эти исследования предполагают, что гомеостаз микробиоты необходим для поддержания благоприятных симбиотических отношений.

    С этой целью MIS разработала несколько способов поддержания гомеостаза микробиоты и хозяина и защиты от патогенов. PRR врожденной иммунной системы, особенно TLR и NOD-подобные рецепторы (NLR), играют важную роль в этих процессах. И TLR, и NLR распознают множество широко консервативных микробных компонентов.

    Распознавание образов в кишечнике

    Учитывая потенциально подавляющую микробную биомассу в кишечнике и тот факт, что несколько PRR могут ощущать свои родственные агонисты на пикомолярных уровнях, хозяин разработал ряд эффективных механизмов для предотвращения постоянной / повторяющейся активации PRR, в то время как поддержание способности активировать PRR, когда это необходимо, чтобы максимизировать преимущества, предоставляемые микробиотической стабильностью [и].

    Таблица 1

    Лиганды рецепторов распознавания образов

    Рецептор Микробный продукт Ссылки
    TLR-1 (с TLR-2) липопротеины липопротеины Микобактерии липопротеины и др. , 2002
    Shimizu, Kida et al. , 2007
    TLR-2 (с TLR-1 или TLR-6) грамположительные бактерии
    Пептидогликан, липотейхоевая кислота
    Зимозан, липарабиноманнан
    Бактериальные гликолипиды, дрожжевой краузин 43 GPI
    354 ЛПС из Leptospira interrogans
    ЛПС из Porphyromonas gingivalis (более цилиндрический)
    Aliprantis, Yang et al., 1999; Schwandner, Dziarski et al. , 1999; Такеучи, Хосино и др. , 1999; Хаджар, О’Махони и др. , 2001; Opitz, Schroder et al. , 2001; Werts, Tapping et al. , 2001; Коэльо, Кляйн и др. , 2002; Massari, Henneke et al. , 2002
    TLR-3 Вирусная дцРНК, синтетическая полиинозиновая кислота: цитидиловая кислота (поли I: C) Alexopoulou, Holt et al. , 2001
    TLR-4 Грамотрицательные бактерии
    ЛПС (коническая форма), пневмолизин
    Липид А (строго цилиндрический, антагонист)
    ЛПС из Rhodobacter sphaeroides (строго цилиндрический)
    Flavolipium mens.
    Респираторно-синцитиальный вирусный белок F
    Aspergillus fumigatus hyphae
    HSP 60 и 70, гиалуронан
    Домен фибронектина A, фибриноген
    Некротические клетки, насыщенные жирные кислоты, таксол (только у мышей)
    Poltora35., 1998; Кавасаки, Акаши и др. , 2000; Курт-Джонс, Попова и др. , 2000; Охаши, Буркарт и др. , 2000; Берд-Лейфер, Блок и др. , 2001; Окамура, Ватари и др. , 2001; Смайли, Кинг и др. , 2001; Bulut, Faure et al. , 2002; Джонсон, Брун и др. , 2002; Расса, Мейерс и др. , 2002; Termeer, Benedix et al. , 2002; Vabulas, Ahmad-Nejad et al. , 2002; Хуанг, Рутковски и др., 2012
    TLR-5 Флагеллин Hayashi, Smith et al. , 2001
    TLR-6 (с TLR-2) Липопротеины микоплазмы, липотейхоевая кислота, пептидогликан Schwandner, Dziarski et al. , 1999; Морр, Такеучи и др. , 2002
    TLR-7 и TLR-8 Одноцепочечная РНК, имидазохиналоны Diebold, Kaisho et al. , 2004; Heil, Hemmi et al., 2004
    TLR-9 CpG ДНК, гемозоин Hemmi, Takeuchi et al. , 2000
    TLR-10 Неизвестно
    TLR-11 Уропатогенные бактерии
    Профилин-подобная молекула белка в Toxoplasma gondii Zhang 5, Zhang et al. , 2004; Кобланский, Янкович и др. , 2013
    TLR-12 Профилин-подобная молекула белка в Toxoplasma gondii Koblansky, Jankovic et al., 2013
    RIG-1 5′-трифосфорилированная дцРНК Yoneyama, Kikuchi et al. , 2004
    MDA-5 Длинная дцРНК Kato, Takeuchi et al. , 2008
    Протеинкиназа R dsRNA Williams 2001
    Dectin-I β-глюканы Brown, Taylor et al. , 2002
    Рецептор маннозы Липарабиноманнан Schlesinger, Hull et al., 1994
    рецептор f-MLP f-MLP Boulay, Tardif et al. , 1990
    Moesin LPS Amar, Oyaisu et al. , 2001; Иончева, Амар и др. , 2004

    Таблица 2

    Нуклеотидсвязывающие и олигомеризационные домеподобные рецепторы

    Семейство Рецептор Лиганды Ссылки ??
    NLRB NAIPs Флагеллин, палочковидные белки Kofoed and Vance 2011
    NLRC NOD-1 γ-d-iED-Dluso-DAP (9ED-Dluso) , мезо -DAP, d-лактил-l-ala-γ-Glu- мезо -DAP-Gly (FK156), гептанолил-γ-Glu- мезо -DAP-d-ala (FK565) Chamaillard, Hashimoto et al., 2003; Girardin, Travassos et al. , 2003; Wilmanski, Petnicki-Ocwieja et al. , 2008
    NOD-2 Мурамилдипептид (MDP), MurNAc-l-Ala-γ-d-Glu-l-Lys (M-TRILys) Girardin, Boneca et al. , 2003; Girardin, Travassos et al. , 2003
    NLRC3 / C5 / X1 ??
    NLRC4 Флагеллин, система секреции бактерий 3-го типа (T3SS) Lightfield, Persson et al., 2008; Мяо, Мао и др. , 2010
    NLRP NLRP1 Бактериальные токсины, MDP, пониженный уровень цитозольного АТФ (?) Boyden and Dietrich 2006; Faustin, Lartigue et al. , 2007; Frew, Joag et al. , 2012; Левинсон, Ньюман и др. , 2012; Liao and Mogridge 2013
    NLRP3 Токсины, бактериальная и вирусная РНК, oxMito-ДНК, церамид, кардиолипин, отток K +, митохондриальные / лизосомные нарушения, ROS, кристаллы / агрегаты, передача сигналов Ca ++, Ex-ATP, кристаллы кремнезема и соли алюминия Hornung, Bauernfeind et al., 2008; Tschopp and Schroder 2010; Leemans, Cassel et al. , 2011
    NLRP6 Бактериальные продукты (?) Ананд, Малиредди и др. , 2012; Anand and Kanneganti 2013
    NLRP7 Бактериальные ацилированные липопептиды (acLP) Khare, Dorfleutner et al. , 2012
    NLRP10 ??
    NLRP11 ??
    NLRP12 Ацилированный липид A Lupfer and Kanneganti 2013
    NLRX NLRX1 Poly I: C 35, 2012

    Помимо физических препятствий для активации PRR обильными микробными лигандами просвета [и], а именно вышеупомянутым толстым слоем слизи, насыщенным антибактериальными соединениями, существуют дополнительные механизмы для ингибирования аберрантной активации PRR в кишечнике. Одним из таких механизмов является избирательность кишечника в отношении типов клеток и условий, в которых экспрессируются TLR. Например, TLR 2 и 4, рецепторы для компонентов стенки бактериальной клетки, пептидогликана и LPS, соответственно, почти не экспрессируются в здоровых IEC, но активируются в условиях, связанных с IBD. [85] Кроме того, активация TLR-4, наиболее провоспалительного из PRR, в IEC также предотвращается за счет ограничения доступности корецепторов, фактора миелоидной дифференцировки 2 (MD-2), CD14 и LPS- связывающий белок. [86] TLR 2 и 4 также экспрессируются на более высоких уровнях с помощью IECs, которые еще не мигрировали вверх по ворсинкам, гарантируя, что надежная активация этих PRR происходит только в том случае, если крипта, которая обычно не колонизируется, находится под угрозой. [87] Кроме того, рецептор флагеллина, TLR-5, экспрессируется только на базолатеральной стороне IECs, стратегия, которая позволяет хозяину генерировать ответ только на инвазивные жгутиковые микробы. [88] TLR-9 уникален среди TLR в том смысле, что он способен подавлять передачу сигналов через все TLR. В то время как базолатеральная активация TLR-9 микробиотной ДНК вызывает классический ядерный фактор, усиливающий каппа-легкую цепь активированных В-клеток (NF-κB), опосредованный воспалительным ответом, апикальный TLR-9 ослабляет такой ответ через альтернативный путь передачи сигналов, который притупляет Активность ИЛ-8, ингибирующая хемотаксис нейтрофилов. [89,90] Кроме того, постоянное воздействие их соответствующих лигандов может привести к иммунологической толерантности, механизму, который также может защитить от аберрантного воспаления и даже аутоиммунитета. [91] Таким образом, врожденный иммунный ответ в кишечнике можно рассматривать как предотвращение чрезмерной активации PRR, которая могла бы возникнуть, если микробиота не управлялась должным образом. Такой жесткий контроль за взаимодействиями микробиоты и PRR служит для ограничения аберрантного воспаления.

    Сходным образом нуклеотидсвязывающие и олигомеризационные домены (NOD) -подобные рецепторы (NLR) эволюционировали в IEC, чтобы избежать сверхактивных воспалительных реакций на резидентную микробиоту, а также для сохранения целостности и функций эпителиального барьера путем поддержания гомеостаза.Недавние исследования кишечной микробиоты в контексте дефицита NLR показывают, что врожденные изменения плотности или численности бактерий могут лежать в основе развития воспалительных заболеваний. Инфламмасомы стали центральными регуляторами кишечной инфекции, иммунитета и воспаления. В дополнение к опосредованию целостности кишечного эпителия, антимикробным ответам и инициированию воспаления посредством генерации цитокинов IL-1β и IL-18, инфламмасома, по-видимому, играет ключевую роль в контроле состава кишечной микробиоты. [92] Мыши с дефицитом инфламмасомы демонстрируют аберрантное микробное сообщество, которое преимущественно передается здоровым мышам, что приводит к передаче неалкогольной жировой болезни печени (НАЖБП), ожирению, воспалению кишечника и раку. [93,94]

    Факторы транскрипции в кишечном иммунитете

    Сигнальный путь NF-κB в эпителии кишечника имеет решающее значение не только для секреции множества хемоаттрактантов, но также для индукции противомикробных и провоспалительных ферментов, таким образом, играет ключевую роль в эпителиальном гомеостазе.Соответственно, IEC-специфическое ингибирование NF-κB посредством условного удаления эссенциального модулятора NF-κB (NEMO) (IκB-киназа-гамма, необходимого для активации NF-κB) вызывает спонтанное хроническое воспаление кишечника у мышей. [95] Дефицит NF-κB привел к апоптозу эпителиальных клеток толстой кишки, сопровождающемуся нарушением экспрессии антимикробных пептидов и транслокацией бактерий в слизистую оболочку. [95] Одновременно этот эпителиальный дефект вызвал хронический воспалительный ответ в толстой кишке, в котором сначала преобладали клетки врожденного иммунитета, но позже вовлекались и Т-лимфоциты.Важно отметить, что дефицит гена, кодирующего адаптерный белок MyD88, предотвращает развитие воспаления кишечника, демонстрируя, что активация TLR кишечными бактериями важна для патогенеза заболевания. [95] Однако, даже если активация TLR кишечными бактериями важна для патогенеза заболевания, передачу сигналов TLR следует рассматривать скорее как полезный путь, который также может стать вредным в ситуации иммунодефицита, такой как делеция NEMO. Более того, активация TLR микробиотой имеет решающее значение для защиты от повреждения кишечника и связанной с этим смертности, выявляя защитную функцию TLR при взаимодействии между хозяином и микробом. [96,97] Помимо NF-κB, несколько других факторов транскрипции, таких как T-bet и семейство STAT, также играют роль в гомеостазе кишечника. [98–101]

    Бактериальные метаболиты в развитии MIS

    Известно, что микробиота играет ключевую роль в развитии собственной лимфоидной системы кишечника и гомеостаза кишечника. Однако механизм, с помощью которого сигналы и метаболиты микробиоты управляют гомеостазом кишечника, был в значительной степени неизвестен. В недавнем исследовании Smith et al. обнаружил, что короткоцепочечные жирные кислоты (SCFA), такие как ацетат, бутират и пропионат, образующиеся в результате бактериальной ферментации пищевых волокон, играют ключевую роль в расширении Treg-клеток кишечной, но не внекишечной лимфоидной ткани. [102] SCFAs специфически увеличивают количество как у гнотобиотических, так и у обычных мышей. Кроме того, с помощью экспериментов по совместному культивированию было обнаружено, что SCFAs улучшают ингибирующую активность Treg в отношении CD4 +. [102] В модели хронического колита с адоптивным переносом Т-клеток мыши, предварительно обработанные только пропионатом или смесью SCFA, были существенно защищены по сравнению с контрольными мышами.В аналогичной строке Arpaia et al. обнаружил, что бутират, продуцируемый микробиотой, способствует экстратимической генерации Treg-клеток. [103] Кроме того, пропионат усиливал de novo генерацию Treg на периферии. Эти исследования демонстрируют, что не только ассоциированные с бактериями лиганды могут участвовать в правильном развитии MIS хозяина, но также их метаболиты могут глубоко влиять на генерацию ключевых популяций регуляторных клеток адаптивной иммунной системы.

    Кишечный иммунитет к небактериальным организмам

    Иммунная система кишечника способна вызывать иммунные ответы не только на бактерии, но и на множество простейших паразитов, таких как Toxoplasma, Entoamoeba, и Giardia, , количество которых растет. создает серьезную проблему, особенно у хозяев с ослабленным иммунитетом. [104] В то время как восприимчивость к хронической инфекции передается за счет цитокиновых ответов Th2 (характеризующихся продуцированием IL-12, IL-18 и IFN-γ), иммунитет к взрослым нематодным червям, обитающим в кишечнике, критически зависит от Th3 цитокиновый ответ (контролируемый цитокинами IL-4, IL-5, IL-9 и IL-13).Недавно было показано, что заражение мышей Toxoplasma gondii приводит к дисбактериозу микробиоты, [105] , характеризующемуся временным обогащением Enterobacteriaceae, принадлежащими Proteobacteria. Ключевое наблюдение в этом исследовании заключается в том, что мышей, инфицированных T. gondii , демонстрировали потерю клеток Панета в тонком кишечнике из-за повреждения митохондрий, которое зависело от микробиоты, передачи сигналов TLR-11, IFN-γ и MyD88 в CD4 + Т-клетках. . [105] Интересно, что т.gondii -индуцированный дисбиоз микробиоты в некоторой степени похож на микробиотические изменения, наблюдаемые на животных моделях воспаления кишечника и при ВЗК человека, подчеркивая условно-патогенную активность семейства Enterobacteriaceae, в частности E. coli . В совокупности это исследование демонстрирует, что TLR не только помогают сохранить микробиотический гомеостаз, но также влияют на дисбактериоз, повреждая клетки-хозяева, которые обычно секретируют антимикробные пептиды.

    Диета и иммунитет кишечника

    В настоящее время многочисленные исследования показали, что диета прямо или косвенно играет важную роль в раннем развитии иммунной системы кишечника.В частности, помимо основных макроэлементов, большое влияние на MIS могут оказывать такие микроэлементы, как витамины A и D, и минералы, такие как железо. Недавнее добавление к списку все более заметных диетических компонентов — это химические вещества, присутствующие в овощах, в частности, из семейства Brassicaceae, а также лактоза в молоке. Некоторые диетические факторы также способствуют патогенезу заболевания, в том числе молочный жир, действующий как колитогенный фактор у восприимчивых мышей, способствуя росту конкретной бактерии, Bilophila wadsworthia . [106]

    Давно известно, что богатые глютеном белки (пшеница, рожь) являются движущими факторами в этиологии целиакии (БК). Хотя вклад адаптивного иммунитета в патогенез CD хорошо известен, доказательства прямого участия врожденного иммунитета, который необходим для установления связи адаптивного иммунитета, отсутствуют. Недавнее исследование устраняет этот пробел, демонстрируя, что молекулы устойчивости к вредителям [ингибиторы α-амилазы / трипсина (ATI) CM3 и 0,19] в пшенице действуют как сильные активаторы моноцитов, макрофагов и DC через TLR-4 – MD2 – CD14, таким образом, инициирование иммунного ответа, который приводит к активации адаптивного иммунитета (Т-лимфоцитов), который управляет патогенезом CD. [107]

    Заключение

    В заключение, кишечную иммунную систему млекопитающих следует рассматривать как сложное взаимодействие между физическими, химическими и клеточными барьерами, обширным сообществом бактерий и множеством иммунных клеток хозяина, которые опосредуют врожденные и адаптивный иммунитет. Кишечная микробиота помогает в правильном развитии иммунной системы хозяина, которая, в свою очередь, регулирует гомеостаз микробиоты. [108] Накопление доказательств за последнее десятилетие показывает, что взаимодействие MIS и микробиоты должно быть точно сбалансировано, и любые нарушения этого взаимодействия могут привести к микробиотическому и иммунному дисбиозу, ведущему к воспалительным нарушениям.Быстрый всплеск возникающих заболеваний нового поколения, таких как ВЗК, ревматоидный артрит, сердечно-сосудистые заболевания и метаболический синдром, побудил исследователей изучить их этиологию во многих направлениях, таких как генетика, диета и факторы окружающей среды, а также взаимодействия MIS и микробиоты. . Кроме того, соблюдение строгих гигиенических и санитарных условий и потребление продуктов с высокой степенью обработки, содержащих большое количество жиров, углеводов и клетчатки, с многочисленными пищевыми добавками и консервантами, может быть причиной изменения микробного состава, метаболизма и взаимодействия с иммунитетом хозяина.Почти все вышеперечисленные заболевания характеризуются как местным, так и системным хроническим или субклиническим воспалением слабой степени, при котором воспаление возникает в кишечнике в результате взаимодействия между MIS хозяина и микробиотой. Гиппократ (460–370 гг. До н.э.) утверждал: «Все болезни начинаются в кишечнике».

    Ссылки

    1. Оресик М., Сеппанен-Лааксо Т., Йетукури Л., Бэкхед Ф., Ханнинен В. Микробиота кишечника влияет на липидный состав хрусталика и сетчатки. Exp Eye Res. 2009; 89: 604–7. [PubMed] [Google Scholar] 2.Hamer HM, Jonkers D, Venema K, Vanhoutvin S, Troost FJ, Brummer RJ. Обзорная статья: роль бутирата в функции толстой кишки. Алимент Pharmacol Ther. 2008; 27: 104–19. [PubMed] [Google Scholar] 3. Кейн М., Кейс Л.К., Копаски К., Козлова А., МакДирмид С., Червонский А.В. и др. Успешная передача ретровируса зависит от комменсальной микробиоты. Наука. 2011; 334: 245–9. [Бесплатная статья PMC] [PubMed] [Google Scholar] 4. Kuss SK, Best GT, Etheredge CA, Pruijssers AJ, Fierson JM, Hooper LV и др. Кишечная микробиота способствует репликации кишечного вируса и системному патогенезу.Наука. 2011; 334: 249–52. [Бесплатная статья PMC] [PubMed] [Google Scholar] 7. Slack E, Hapfelmeier S, Stecher B, Velykoredko Y, Stoel M, Lawson MA и др. Врожденный и адаптивный иммунитет гибко взаимодействуют, чтобы поддерживать мутуализм хозяина и микробиоты. Наука. 2009; 325: 617–20. [Бесплатная статья PMC] [PubMed] [Google Scholar] 8. Hoshi H, Aijima H, Horie K, Nagata H, Kaneko T., Ikeda T. Лимфатические фолликулы и зародышевые центры в подколенных лимфатических узлах и других лимфоидных тканях стерильных и обычных крыс. Tohoku J Exp Med.1992; 166: 297–307. [PubMed] [Google Scholar] 9. Тернер-младший. Барьерная функция слизистой оболочки кишечника при здоровье и болезни. Nat Rev Immunol. 2009; 9: 799–809. [PubMed] [Google Scholar] 10. Йоханссон М.Э., Филлипсон М., Петерссон Дж., Вельчич А., Холм Л., Ханссон Г.С. Внутренний из двух слоев слизи, зависимой от муцина Muc2 в толстой кишке, лишен бактерий. Proc Natl Acad Sci USA. 2008; 105: 15064–9. [Бесплатная статья PMC] [PubMed] [Google Scholar] 13. Hasnain SZ, Gallagher AL, Grencis RK, Thornton DJ. Новая роль муцинов в иммунитете: данные о желудочно-кишечной нематодной инфекции.Int J Biochem Cell Biol. 2013; 45: 364–74. [PubMed] [Google Scholar] 14. Шекельс Л.Л., Анвей Р.Э., Лин Дж., Кеннеди М.В., Гарсайд П., Лоуренс К.Э. и др. Скоординированная экспрессия гена муцина Muc2 и Muc3 при инфекции Trichinella spiralis у мышей дикого типа и мышей с дефицитом цитокинов. Dig Dis Sci. 2001; 46: 1757–64. [PubMed] [Google Scholar] 15. Пиллаи К., Пургхолами М.Х., Чуа Т.К., Моррис Д.Л. MUC1 как потенциальная мишень в противоопухолевой терапии. Am J Clin Oncol. DOI 2013: 10.1097 / COC.0b013e31828f5a07. [PubMed] [CrossRef] [Google Scholar] 16.Ван дер Слуис М., Де Конинг Б.А., Де Брюйн А.С., Вельчич А., Мейеринк Дж. П., Ван Гудувер Дж. Б. и др. У мышей с дефицитом Muc2 спонтанно развивается колит, что указывает на то, что MUC2 имеет решающее значение для защиты толстой кишки. Гастроэнтерология. 2006; 131: 117–29. [PubMed] [Google Scholar] 17. McDole JR, Wheeler LW, McDonald KG, Wang B, Konjufca V, Knoop KA и др. Бокаловидные клетки доставляют люминальный антиген к дендритным клеткам CD103 + в тонком кишечнике. Природа. 2012; 483: 345–9. [Бесплатная статья PMC] [PubMed] [Google Scholar] 18. Вэй X, Ян З., Рей Ф. Е., Ридаура В. К., Дэвидсон Н. О., Гордон Дж. И. и др.Синтаза жирных кислот модулирует функцию кишечного барьера посредством пальмитоилирования муцина 2. Клеточный микроб-хозяин. 2012; 11: 140–52. [Бесплатная статья PMC] [PubMed] [Google Scholar] 19. Вареди М., Грили Г. Х., младший, Херндон Д. Н., Англичанин Е. В.. Циркулирующий фактор (ы), вызванный термическим повреждением, ставит под угрозу морфологию, пролиферацию и миграцию кишечных клеток. Am J Physiol. 1999; 277: G175–82. [PubMed] [Google Scholar] 20. Гордон Дж. И., Шмидт Г. Х., Рот К. А.. Исследования стволовых клеток кишечника на нормальных, химерных и трансгенных мышах.FASEB J. 1992; 6: 3039–50. [PubMed] [Google Scholar] 21. Митич Л.Л., Андерсон Дж. М.. Молекулярная архитектура плотных контактов. Annu Rev Physiol. 1998. 60: 121–42. [PubMed] [Google Scholar] 22. Брант С.Р., Панхуисен К.И., Николае Д., Редди Д.М., Бонен Д.К., Каралюкас Р. и др. Полиморфизм MDR1 Ala893 связан с воспалительным заболеванием кишечника. Am J Hum Genet. 2003. 73: 1282–92. [Бесплатная статья PMC] [PubMed] [Google Scholar] 23. Панвала С.М., Джонс Дж. К., Вини Дж. Л.. Новая модель воспалительного заболевания кишечника: у мышей с дефицитом гена множественной лекарственной устойчивости mdr1a спонтанно развивается колит.J Immunol. 1998. 161: 5733–44. [PubMed] [Google Scholar] 25. Маккормик Б.А., Колган С.П., Дельп-Арчер С., Миллер С.И., Мадара Дж.Л. Присоединение Salmonella typhimurium к монослоям кишечного эпителия человека: трансклеточная передача сигналов субэпителиальным нейтрофилам. J Cell Biol. 1993; 123: 895–907. [Бесплатная статья PMC] [PubMed] [Google Scholar] 26. Китс С., Китс А.С., Мидзогучи Е., Бхан А., Келли С.П. Энтероциты являются основным источником хемокина ENA-78 при нормальной толстой кишке и при язвенном колите. Am J Physiol. 1997; 273: G75–82.[PubMed] [Google Scholar] 27. Двинелл МБ, Йохансен П.А., Смит Дж. М.. Иммунобиология эпителиальных хемокинов слизистой оболочки кишечника. Операция. 2003. 133: 601–7. [PubMed] [Google Scholar] 28. Гасперини С., Марчи М., Кальцетти Ф., Лауданна С., Вичентини Л., Олсен Х. и др. Экспрессия генов и продукция монокина, индуцированная IFN-гамма (MIG), IFN-индуцируемым альфа-хемоаттрактантом T-клеток (I-TAC) и IFN-гамма-индуцируемым протеином-10 (IP-10) хемокинами нейтрофилами человека. J Immunol. 1999; 162: 4928–37. [PubMed] [Google Scholar] 29.Шибахара Т., Уилкокс Дж. Н., Коус Т., Мадара Дж. Л.. Характеристика эпителиальных хемоаттрактантов для интраэпителиальных лимфоцитов кишечника человека. Гастроэнтерология. 2001; 120: 60–70. [PubMed] [Google Scholar] 30. Кромвель О., Хамид К., Корриган С.Дж., Барканс Дж., Мэн К., Коллинз П.Д. и др. Экспрессия и генерация интерлейкина-8, IL-6 и фактора, стимулирующего колонию гранулоцитов-макрофагов, бронхиальными эпителиальными клетками и усиление IL-1 бета и фактором некроза опухоли альфа. Иммунология. 1992; 77: 330–7. [Бесплатная статья PMC] [PubMed] [Google Scholar] 31.Ситараман С.В., Мерлин Д., Ван Л., Вонг М., Гевирц А.Т., Си-Тахар М. и др. Нейтрофил-эпителиальный перекрестный контакт на поверхности просвета кишечника, опосредованный реципрокной секрецией аденозина и ИЛ-6. J Clin Invest. 2001; 107: 861–9. [Бесплатная статья PMC] [PubMed] [Google Scholar] 32. Лю Й., Буринг Х. Дж., Зен К., Burst SL, Шнелл Ф. Дж., Уильямс И. Р. и др. Сигнальный регуляторный белок (SIRPalpha), клеточный лиганд для CD47, регулирует трансмиграцию нейтрофилов. J Biol Chem. 2002; 277: 10028–36. [PubMed] [Google Scholar] 33.Parkos CA, Colgan SP, Liang TW, Nusrat A, Bacarra AE, Carnes DK, et al. CD47 опосредует постадгезивные события, необходимые для миграции нейтрофилов через поляризованный эпителий кишечника. J Cell Biol. 1996; 132: 437–50. [Бесплатная статья PMC] [PubMed] [Google Scholar] 34. Colgan SP, Parkos CA, Delp C, Arnaout MA, Madara JL. Миграция нейтрофилов через культивируемые монослои кишечного эпителия модулируется воздействием на эпителий IFN-гамма сильно поляризованным образом. J Cell Biol. 1993; 120: 785–98. [Бесплатная статья PMC] [PubMed] [Google Scholar] 35.Аксентиевич И., Мастерс С.Л., Фергюсон П.Дж., Дэнси П., Френкель Дж., Ван Ройен-Керкхофф А. и др. Аутовоспалительное заболевание с дефицитом антагониста рецепторов интерлейкина-1. N Engl J Med. 2009; 360: 2426–37. [Бесплатная статья PMC] [PubMed] [Google Scholar] 36. Аренд В.П., Маляк М., Гатридж С.Дж., Габай С. Антагонист рецептора интерлейкина-1: роль в биологии. Анну Рев Иммунол. 1998. 16: 27–55. [PubMed] [Google Scholar] 37. Молнарфи Н., Хика-Носпикель Н., Груаз Л., Дайер Дж. М., Бургер Д. Производство антагониста рецептора ИЛ-1 в моноцитах человека, стимулированных ИФН-бета, зависит от активации фосфатидилинозитол-3-киназы, но не STAT1.J Immunol. 2005; 174: 2974–80. [PubMed] [Google Scholar] 38. Карвалью Ф.А., Эйткен Д.Д., Гевиртц А.Т., Виджай-Кумар М. Активация TLR5 индуцирует секреторный антагонист рецептора интерлейкина-1 (sIL-1Ra) и снижает повреждение тканей, связанное с воспалением массом. Mucosal Immunol. 2011; 4: 102–11. [Бесплатная статья PMC] [PubMed] [Google Scholar] 40. Kraehenbuhl JP, Neutra MR. Эпителиальные М-клетки: дифференциация и функция. Annu Rev Cell Dev Biol. 2000; 16: 301–32. [PubMed] [Google Scholar] 41. Джепсон М.А., Кларк М.А., Херст Б.Н. Нацеливание на М-клетки лектинами: стратегия вакцинации слизистых оболочек и доставки лекарств.Adv Drug Deliv Rev. 2004; 56: 511–25. [PubMed] [Google Scholar] 42. Пикард Ю.М., Червонский А.В. Забор кишечной микробиоты эпителиальными М-клетками. Curr Gastroenterol Rep. 2010; 12: 331–9. [PubMed] [Google Scholar] 43. Баумлер А.Дж., Цолис Р.М., Хеффрон Ф. Фимбриальный оперон lpf опосредует адгезию Salmonella typhimurium к мышиным пятнам Пейера. Proc Natl Acad Sci USA. 1996; 93: 279–83. [Бесплатная статья PMC] [PubMed] [Google Scholar] 44. Chassaing B, Rolhion N, de Vallee A, Salim SY, Prorok-Hamon M, Neut C и др.Связанные с болезнью Крона адгезивно-инвазивные бактерии E. coli нацелены на мышиные и человеческие пятна Пейера через длинные полярные фимбрии. J Clin Invest. 2011; 121: 966–75. [Бесплатная статья PMC] [PubMed] [Google Scholar] 45. Jang MH, Kweon MN, Iwatani K, Yamamoto M, Terahara K, Sasakawa C и др. М-клетки ворсинок кишечника: сайт проникновения антигена в эпителий слизистой оболочки. Proc Natl Acad Sci USA. 2004. 101: 6110–5. [Бесплатная статья PMC] [PubMed] [Google Scholar] 47. Clevers HC, Bevins CL. Клетки Панета: Маэстро крипт тонкого кишечника.Annu Rev Physiol. 2013; 75: 289–311. [PubMed] [Google Scholar] 48. Гош Д., Портер Э., Шен Б., Ли С.К., Уилк Д., Дразба Дж. И др. Трипсин клеток Панета является процессирующим ферментом дефенсина-5 человека. Nat Immunol. 2002; 3: 583–90. [PubMed] [Google Scholar] 49. Пуцеп К., Аксельссон Л.Г., Боман А., Мидтведт Т., Нормарк С., Боман Х.Г. и др. Свободные от зародышей и колонизированные мыши производят одни и те же продукты из кишечных продефенсинов. J Biol Chem. 2000; 275: 40478–82. [PubMed] [Google Scholar] 50. Ayabe T, Satchell DP, Wilson CL, Parks WC, Selsted ME, Ouellette AJ.Секреция микробицидных альфа-дефенсинов кишечными клетками Панета в ответ на бактерии. Nat Immunol. 2000; 1: 113–8. [PubMed] [Google Scholar] 51. Смитис Л. Е., Продавцы М., Клементс Р. Х., Мостеллер-Барнум М., Менг Г., Бенджамин У. С. и др. Макрофаги кишечника человека проявляют сильную воспалительную анергию, несмотря на активную фагоцитарную и бактерицидную активность. J Clin Invest. 2005; 115: 66–75. [Бесплатная статья PMC] [PubMed] [Google Scholar] 53. Мурай М., Туровская О., Ким Дж., Мадан Р., Карп С.Л., Черутре Х. и др.Интерлейкин 10 действует на регуляторные Т-клетки, поддерживая экспрессию фактора транскрипции Foxp3 и подавляя функцию у мышей с колитом. Nat Immunol. 2009. 10: 1178–84. [Бесплатная статья PMC] [PubMed] [Google Scholar] 54. Ругтвейт Дж., Бакка А., Брандтзаег П. Дифференциальное распределение B7.1 (CD80) и B7. 2 (CD86) костимулирующие молекулы на подмножествах макрофагов слизистой оболочки при воспалительном заболевании кишечника (ВЗК) человека Clin Exp Immunol. 1997; 110: 104–13. [Бесплатная статья PMC] [PubMed] [Google Scholar] 55. Куаллс Дж. Э., Каплан А. М., ван Ройен Н., Коэн Д. А..Подавление экспериментального колита мононуклеарными фагоцитами кишечника. J Leukoc Biol. 2006; 80: 802–15. [PubMed] [Google Scholar] 56. Макдональд К.П., Палмер Дж. С., Кронау С., Сеппанен Э., Олвер С., Раффельт NC и др. Антитело против рецептора колониестимулирующего фактора 1 истощает резидентную субпопуляцию моноцитов и макрофагов, ассоциированных с тканями и опухолями, но не подавляет воспаление. Кровь. 2010; 116: 3955–63. [PubMed] [Google Scholar] 57. Hontecillas R, Horne WT, Climent M, Guri AJ, Evans C, Zhang Y и др.Иммунорегуляторные механизмы макрофагов PPAR-гамма у мышей с экспериментальным воспалительным заболеванием кишечника. Mucosal Immunol. 2011; 4: 304–13. [Бесплатная статья PMC] [PubMed] [Google Scholar] 58. Kuhn R, Lohler J, Rennick D, Rajewsky K, Muller W. У мышей с дефицитом интерлейкина-10 развивается хронический энтероколит. Клетка. 1993; 75: 263–74. [PubMed] [Google Scholar] 59. Такеда К., Клаусен Б.Е., Кайсё Т., Цудзимура Т., Терада Н., Форстер И. и др. Повышенная активность Th2 и развитие хронического энтероколита у мышей, лишенных Stat3 в макрофагах и нейтрофилах.Иммунитет. 1999; 10: 39–49. [PubMed] [Google Scholar] 60. Иванов И.И., де Фрутос Р.Л., Манель Н., Йошинага К., Рифкин Д.Б., Сартор РБ и др. Специфическая микробиота направляет дифференцировку Т-хелперных клеток, продуцирующих ИЛ-17, в слизистой оболочке тонкой кишки. Клеточный микроб-хозяин. 2008; 4: 337–49. [Бесплатная статья PMC] [PubMed] [Google Scholar] 61. Штраух У.Г., Обермайер Ф., Грюнвальд Н., Гурстер С., Дангер Н., Шульц М. и др. Влияние кишечных бактерий на индукцию регуляторных Т-клеток: уроки модели переноса колита.Кишечник. 2005; 54: 1546–52. [Бесплатная статья PMC] [PubMed] [Google Scholar] 62. Болезнь Брэнда С. Крона: Th2, Th27 или оба? Изменение парадигмы: новые иммунологические и генетические открытия указывают на то, что клетки Th27 участвуют в патогенезе болезни Крона. Кишечник. 2009. 58: 1152–67. [PubMed] [Google Scholar] 63. Aggarwal S, Ghilardi N, Xie MH, de Sauvage FJ, Gurney AL. Интерлейкин-23 способствует определенному состоянию активации CD4 Т-клеток, характеризующемуся продуцированием интерлейкина-17. J Biol Chem. 2003. 278: 1910–4. [PubMed] [Google Scholar] 64.Bettelli E, Carrier Y, Gao W., Korn T., Strom TB, Oukka M и др. Взаимные пути развития для генерации патогенных эффекторных Th27 и регуляторных Т-клеток. Природа. 2006; 441: 235–8. [PubMed] [Google Scholar] 65. Mangan PR, Harrington LE, O’Quinn DB, Helms WS, Bullard DC, Elson CO и др. Трансформирующий фактор роста бета индуцирует развитие линии T (H) 17. Природа. 2006; 441: 231–4. [PubMed] [Google Scholar] 67. Lelouard H, Fallet M, de Bovis B, Meresse S, Gorvel JP. Дендритные клетки Пейера отбирают образцы антигенов, протягивая дендриты через специфичные для М-клеток трансцеллюлярные поры.Гастроэнтерология. 2012; 142: 592–601.e3. [PubMed] [Google Scholar] 68. Rescigno M, Urbano M, Valzasina B, Francolini M, Rotta G, Bonasio R и др. Дендритные клетки экспрессируют белки с плотными контактами и проникают в монослои эпителия кишечника, чтобы взять образцы бактерий. Nat Immunol. 2001; 2: 361–7. [PubMed] [Google Scholar] 69. Coombes JL, Siddiqui KR, Arancibia-Carcamo CV, Hall J, Sun CM, Belkaid Y, et al. Функционально специализированная популяция CD103 + DC слизистой оболочки индуцирует Foxp3 + регуляторные Т-клетки посредством TGF-бета и механизма, зависимого от ретиноевой кислоты.J Exp Med. 2007. 204: 1757–64. [Бесплатная статья PMC] [PubMed] [Google Scholar] 70. Уокер Дж. А., Барлоу Дж. Л., Маккензи А. Н.. Врожденные лимфоидные клетки — как мы их пропустили? Nat Rev Immunol. 2013; 13: 75–87. [PubMed] [Google Scholar] 71. Пирсон Т., Шульц Л.Д., Миллер Д., Кинг М., Ланинг Дж., Фодор В. и др. Мыши, не страдающие ожирением, активирующие диабетическую рекомбинацию ген-1 (NOD-Rag1 null), рецептор интерлейкина (IL) -2, общая гамма-цепь (IL2r gamma null): радиорезистентная модель лимфогематопоэтического приживления человека. Clin Exp Immunol.2008. 154: 270–84. [Бесплатная статья PMC] [PubMed] [Google Scholar] 72. Tait Wojno ED, Artis D. Врожденные лимфоидные клетки: балансировка иммунитета, воспаления и восстановления тканей в кишечнике. Клеточный микроб-хозяин. 2012; 12: 445–57. [Бесплатная статья PMC] [PubMed] [Google Scholar] 73. Зонненберг Г.Ф., Монтичелли Л.А., Аленгхат Т., Фунг Т.С., Хатник Н.А., Кунисава Дж. И др. Врожденные лимфоидные клетки способствуют анатомическому сдерживанию лимфоидно-резидентных комменсальных бактерий. Наука. 2012; 336: 1321–5. [Бесплатная статья PMC] [PubMed] [Google Scholar] 74.Хупер Л.В., Макферсон А.Дж. Иммунные адаптации, поддерживающие гомеостаз кишечной микробиоты. Nat Rev Immunol. 2010. 10: 159–69. [PubMed] [Google Scholar] 75. Пабст О. Новые концепции в создании и функциях IgA. Nat Rev Immunol. 2012; 12: 821–32. [PubMed] [Google Scholar] 76. Фуката М., Шан Л., Сантаолалла Р., Сотолонго Дж., Пасторини С., Испания С. и др. Конститутивная активация эпителиального TLR4 усиливает воспалительные реакции на повреждение слизистой оболочки и приводит к онкогенезу, связанному с колитом.Воспаление кишечника. 2011; 17: 1464–73. [Бесплатная статья PMC] [PubMed] [Google Scholar] 77. Geuking MB, Cahenzli J, Lawson MA, Ng DC, Slack E, Hapfelmeier S и др. Бактериальная колонизация кишечника вызывает мутуалистические регуляторные Т-клеточные ответы. Иммунитет. 2011; 34: 794–806. [PubMed] [Google Scholar] 78. Кларк JA, Callicoat PA, Brenner NA, Bradley CA, Smith DM., Jr. Селективный дефицит IgA у доноров крови. Am J Clin Pathol. 1983; 80: 210–3. [PubMed] [Google Scholar] 79. Mbawuike IN, Pacheco S, Acuna CL, Switzer KC, Zhang Y, Harriman GR.Иммунитет слизистой оболочки к гриппу без IgA: модель мыши с нокаутом IgA. J Immunol. 1999. 162: 2530–7. [PubMed] [Google Scholar] 80. Хупер Л.В., Мидтведт Т., Гордон Дж. Как взаимодействия хозяина и микробов формируют питательную среду кишечника млекопитающих. Анну Рев Нутр. 2002; 22: 283–307. [PubMed] [Google Scholar] 81. Корен О, Спор А, Фелин Дж., Фак Ф, Стомбо Дж., Тремароли В. и др. Микробиота ротовой полости, кишечника и зубного налета человека у пациентов с атеросклерозом. Proc Natl Acad Sci USA. 2011; 108 (Приложение 1): 4592–8.[Бесплатная статья PMC] [PubMed] [Google Scholar] 82. Корен О., Гудрич Дж. К., Каллендер Т. К., Спор А, Лайтинен К., Бэкхед Х. К. и др. Ремоделирование кишечного микробиома и метаболические изменения хозяина во время беременности. Клетка. 2012; 150: 470–80. [Бесплатная статья PMC] [PubMed] [Google Scholar] 83. Wostmann BS, Larkin C, Moriarty A, Bruckner-Kardoss E. Диетическое потребление, энергетический метаболизм и экскреторные потери взрослых самцов стерильных крыс Wistar. Lab Anim Sci. 1983; 33: 46–50. [PubMed] [Google Scholar] 84. Chassaing B, Aitken JD, Gewirtz AT, Vijay-Kumar M.Микробиота кишечника вызывает метаболические заболевания у иммунологически измененных мышей. Adv Immunol. 2012; 116: 93–112. [PubMed] [Google Scholar] 85. Карвалью Ф.А., Эйткен Д.Д., Виджай-Кумар М., Гевиртц А.Т. Взаимодействие Toll-подобных рецепторов с микробиотой кишечника: беспокойство на свой страх и риск! Annu Rev Physiol. 2012; 74: 177–98. [PubMed] [Google Scholar] 86. Вамадеван А.С., Фуката М., Арнольд Е.Т., Томас Л.С., Хсу Д., Абреу М.Т. Регулирование MD-2, связанного с Toll-подобным рецептором 4, в эпителиальных клетках кишечника: всесторонний анализ. Врожденный иммунитет.2010. 16: 93–103. [Бесплатная статья PMC] [PubMed] [Google Scholar] 87. Фурри Э, Макфарлейн С, Томсон Г, Макфарлейн ГТ. Паттерны экспрессии Toll-подобных рецепторов-2, -3 и -4 в толстой кишке человека и их регуляция с помощью бактерий, связанных со слизистой оболочкой. Иммунология. 2005; 115: 565–74. [Бесплатная статья PMC] [PubMed] [Google Scholar] 88. Гевиртц А.Т., Навас Т.А., Лайонс С., Годовски П.Дж., Мадара Дж.Л. Передний край: бактериальный флагеллин активирует базолатерально экспрессируемый TLR5, чтобы вызвать экспрессию эпителиальных провоспалительных генов. J Immunol.2001; 167: 1882–5. [PubMed] [Google Scholar] 89. Гадими Д., Врезе М., Хеллер К. Дж., Шрезенмейр Дж. Влияние природной ДНК комменсального происхождения на сигнальный каскад толл-подобного рецептора 9 (TLR9), экспрессию хемокинового IL-8 и барьерную интеграцию поляризованных эпителиальных клеток кишечника. Воспаление кишечника. 2010. 16: 410–27. [PubMed] [Google Scholar] 90. Вилайсане А, Муруве Д.А. Врожденный иммунный ответ на ДНК. Semin Immunol. 2009; 21: 208–14. [PubMed] [Google Scholar] 91. Бисвас С.К., Лопес-Коллазо Э. Толерантность к эндотоксинам: новые механизмы, молекулы и клиническое значение.Trends Immunol. 2009. 30: 475–87. [PubMed] [Google Scholar] 92. Элинав Э., Тайс, Калифорния, Флавелл РА. Анализ изменений микробиоты у мышей с дефицитом инфламмасом. Методы Мол биол. 2013; 1040: 185–94. [PubMed] [Google Scholar] 93. Хенао-Мехиа Дж., Элинав Э., Джин С., Хао Л., Мехал В.З., Строиг Т. и др. Инфламмасомный дисбиоз регулирует прогрессирование НАЖБП и ожирения. Природа. 2012; 482: 179–85. [Бесплатная статья PMC] [PubMed] [Google Scholar] 95. Ненси А., Беккер С., Вулларт А., Гареус Р., ван Лоо Г., Данезе С. и др.Эпителиальный NEMO связывает врожденный иммунитет с хроническим воспалением кишечника. Природа. 2007; 446: 557–61. [PubMed] [Google Scholar] 96. Ракофф-Нахум С., Паглино Дж., Эслами-Варзане Ф., Эдберг С., Меджитов Р. Распознавание комменсальной микрофлоры толл-подобными рецепторами необходимо для гомеостаза кишечника. Клетка. 2004. 118: 229–41. [PubMed] [Google Scholar] 97. Джонс Р.М., Слоан В.М., Ву Х., Луо Л., Кумар А., Кумар М.В. и др. Введение флагеллина защищает слизистую оболочку кишечника от апоптоза, вызванного облучением, за счет активности MKP-7.Кишечник. 2011; 60: 648–57. [PubMed] [Google Scholar] 98. Пауэлл Н., Уокер А. В., Столарчик Е., Канаван Дж. Б., Гокмен М. Р., Маркс Е. и др. Фактор транскрипции T-bet регулирует воспаление кишечника, опосредованное рецептором интерлейкина-7 + врожденными лимфоидными клетками. Иммунитет. 2012; 37: 674–84. [Бесплатная статья PMC] [PubMed] [Google Scholar] 99. Гарретт WS, лорд GM, Punit S, Lugo-Villarino G, Mazmanian SK, Ito S, et al. Инфекционный язвенный колит, вызванный дефицитом T-bet во врожденной иммунной системе. Клетка. 2007; 131: 33–45.[Бесплатная статья PMC] [PubMed] [Google Scholar] 100. Neufert C, Pickert G, Zheng Y, Wittkopf N, Warntjen M, Nikolaev A, et al. Активация эпителиального STAT3 регулирует гомеостаз кишечника. Клеточный цикл. 2010; 9: 652–5. [PubMed] [Google Scholar] 101. Пикерт Г., Нойферт С., Леппкес М., Чжэн Ю., Витткопф Н., Варнтьен М. и др. STAT3 связывает передачу сигналов IL-22 в эпителиальных клетках кишечника с заживлением ран слизистой оболочки. J Exp Med. 2009; 206: 1465–72. [Бесплатная статья PMC] [PubMed] [Google Scholar] 102. Smith PM, Howitt MR, Panikov N, Michaud M, Gallini CA, Bohlooly YM, et al.Микробные метаболиты, короткоцепочечные жирные кислоты, регулируют гомеостаз Treg-клеток толстой кишки. Наука. 2013; 341: 569–73. [Бесплатная статья PMC] [PubMed] [Google Scholar] 103. Arpaia N, Campbell C, Fan X, Dikiy S, van der Veeken J, Deroos P и др. Метаболиты, продуцируемые комменсальными бактериями, способствуют образованию периферических регуляторных Т-клеток. Природа. 2013; 504: 451–5. [Бесплатная статья PMC] [PubMed] [Google Scholar] 104. Маркос Л.А., Готуццо Э. Кишечные простейшие инфекции у хозяина с ослабленным иммунитетом. Curr Opin Infect Dis.2013; 26: 295–301. [PubMed] [Google Scholar] 105. Raetz M, Hwang SH, Wilhelm CL, Kirkland D, Benson A, Sturge CR и др. Индуцированные паразитами клетки Th2 и дисбактериоз кишечника взаимодействуют в ИФН-гамма-зависимой элиминации клеток Панета. Nat Immunol. 2013; 14: 136–42. [Бесплатная статья PMC] [PubMed] [Google Scholar] 106. Devkota S, Wang Y, Musch MW, Leone V, Fehlner-Peach H, Nadimpalli A и др. Таурохолевая кислота, индуцированная пищевым жиром, способствует размножению патобионтов и колиту у мышей Il10 — / -. Природа. 2012; 487: 104–8.[Бесплатная статья PMC] [PubMed] [Google Scholar] 107. Юнкер Ю., Цейссиг С., Ким С.Дж., Барисани Д., Визер Х., Леффлер Д.А. и др. Ингибиторы трипсина амилазы пшеницы вызывают воспаление кишечника за счет активации толл-подобного рецептора 4. J Exp Med. 2012; 209: 2395–408. [Бесплатная статья PMC] [PubMed] [Google Scholar] 108. Соммер Ф., Бакхед Ф. Мастера кишечной микробиоты, отвечающие за развитие и физиологию хозяина. Nat Rev Microbiol. 2013; 11: 227–38. [PubMed] [Google Scholar]

    Клеточно-специфическая регуляция кишечного иммунитета

    РЕЗЮМЕ

    Кишечный эпителий содержит клоны секреторных и абсорбирующих клеток, которые развиваются из недифференцированных клеток-предшественников.Несмотря на коллективную важность этих клеток для ответа хозяина против микробных захватчиков, мало что известно о вкладе иммунных ответов отдельных типов клеток в поддержание гомеостаза кишечника. В этом исследовании мы спросили, как ингибирование активности иммунного пути исключительно в клетках-предшественниках или в дифференцированных энтероцитах влияет на гомеостаз средней кишки у взрослых Drosophila . Мы обнаружили, что блокирование иммунной активности в энтероцитах делает мух более толерантными к инфекции Vibrio cholerae , оказывает незначительное влияние на бактериальный микробиом кишечника и значительно влияет на метаболизм.Напротив, ингибирование иммунной активности у предшественников сделало мух менее толерантными к инфекциям Vibrio , изменило ассоциацию хозяина с симбионтами Lactobacillus и заблокировало рост и обновление эпителия средней кишки. Вместе эти данные раскрывают значительный вклад эпителиального иммунитета в специфический для каждого типа клеток вклад в гомеостаз кишечника взрослых.

    ВВЕДЕНИЕ

    Защита кишечника имеет решающее значение для нейтрализации угроз, исходящих от постоянных или временных микробов (1).Антимикробные средства защиты включают физические барьеры, построенные из плотных полимерных материалов, таких как муцины или хитиновый перитрофический матрикс, а также плотные межклеточные контакты, которые предотвращают параклеточную утечку потенциально вредных молекул. В дополнение к барьерной защите, реактивные формы кислорода, происходящие от хозяина, уничтожают инвазивные микробы довольно неизбирательным образом, что может привести к побочным повреждениям ткани хозяина. Наконец, иммунная система полагается на внутри- и внеклеточные рецепторы, которые исследуют кишечную среду на предмет молекулярных паттернов микробного содержимого кишечника (2).Обнаружение микробных сигнатур активирует эволюционно консервативные защитные механизмы хозяина, которые предотвращают микробное вторжение в интерстициальную ткань.

    Drosophila melanogaster представляет собой ценную систему для характеристики молекулярной регуляции иммунных ответов кишечника. Задняя часть средней кишки мух имеет много общего с тонкой кишкой позвоночных и очень подвержена модификации экспрессии генов в определенных клетках кишечника (3). Как и у позвоночных, средняя кишка мух поддерживается базальной популяцией клеток-предшественников, состоящих из кишечных стволовых клеток, которые в основном асимметрично делятся с образованием новой стволовой клетки и переходного типа клеток — энтеробластов (4, 5).Энтеробласты часто реагируют на сигналы пути Notch, генерируя абсорбирующие энтероциты (6, 7), большие дифференцированные клетки, которые претерпевают несколько раундов эндорепликации и занимают основную часть эпителиального объема. Реже стволовые клетки генерируют секреторные энтероэндокринные клетки либо косвенно, через энтеробласты, которые не получают сигналы Notch, либо более напрямую через энтероэндокринный посредник (8-10). Как и у позвоночных, деление стволовых клеток регулируется митогенными сигналами от путей, которые включают EGF, Wnt и JAK-STAT, а скорость деления ISC зависит от скорости повреждения эпителия (11, 12).В отсутствие внешнего стрессора стволовые клетки делятся примерно раз в две недели у взрослых самок (4, 13). Однако повреждение средней кишки активирует пути восстановления, которые изменяют скорость пролиферации ISC. В этом случае молекулярные сигналы от поврежденных клеток ускоряют деление ISC, чтобы создать пул клеток, который восполняет поврежденные структуры и поддерживает эпителиальный барьер.

    В кишечнике мух бактериальный пептидогликан DAP-типа (PGN) активирует путь иммунодефицита (IMD), антибактериальную защиту, кодируемую зародышевой линией, схожую с путем TNF млекопитающих (14–16).IMD регулирует примерно 50% кишечного транскрипционного ответа на микробиоту (17), а изменения иммунной активности связаны с влиянием на состав и нагрузку кишечной микробиоты (15, 17–20). Подобно пищеварительным процессам, путь IMD демонстрирует признаки клеточной и региональной специализации (21–23). В передней части кишечника для активации IMD требуется внеклеточный рецептор PGRP-LC, который обнаруживает полимерный PGN и активирует антибактериальную защиту в крупных дифференцированных клетках (24).В задней части средней кишки для активации IMD требуется PGRP-LE (24, 25), внутриклеточный сенсор, который обнаруживает мономерный PGN (26) и индуцирует экспрессию продуктов иммунных регуляторных генов.

    Хотя были достигнуты успехи в понимании молекулярной и пространственной регуляции кишечной активности IMD, мало исследований спрашивали, выполняет ли IMD отдельные роли в недифференцированных предшественниках по сравнению с их дифференцированным потомством. Мы сочли это важным вопросом, требующим ответа, поскольку компоненты пути IMD экспрессируются и активны в предшественниках средней кишки (27–29), а иммунные пути, кодируемые зародышевой линией, играют критическую гомеостатическую роль в кишечных клетках-предшественниках других организмов.Напр., Мышиные стволовые клетки экспрессируют бактериальные сенсоры NOD2 и TLR4, и оба рецептора вносят вклад в регуляцию жизнеспособности стволовых клеток (30–33). Сходным образом микробиотозависимые сигналы действуют через компонент пути TLR, MyD88, чтобы регулировать рост и дифференцировку в эпителии личинок рыбок данио (34, 35). Учитывая эволюционную консервацию кишечных гомеостатических путей и генетическую доступность Drosophila , мы полагаем, что взрослая муха является отличной системой для характеристики связи между иммунной активностью и эпителиальным гомеостазом.

    Чтобы идентифицировать клеточно-специфические функции IMD в средней кишке взрослых, мы создали трансгенную линию Drosophila , которая позволяет индуцибельное ингибирование IMD в определенных типах клеток. С помощью этой линии мы определили физиологические последствия инактивации IMD исключительно в предшественниках или в энтероцитах. Наши результаты выявили значительные различия между вкладом IMD энтероцитов и IMD клеток-предшественников в гомеостаз кишечника. Ингибирование IMD в энтероцитах увеличивало продолжительность жизни взрослых, зараженных Vibrio cholerae , не влияло на состав кишечного микробиома, но оказывало значительное влияние на метаболизм триглицеридов.Напротив, ингибирование IMD у предшественников сокращало продолжительность жизни мух, зараженных Vibrio cholerae , влияло на репрезентативность симбионтов Lactobacillus в микробиоте и значительно нарушало рост и дифференцировку кишечных стволовых клеток. В совокупности эти данные раскрывают фундаментальные различия между иммунной активностью клеток-предшественников и их дифференцированным потомством и предоставляют доступную модель для анализа клеточно-специфического вклада эпителиального иммунитета в здоровье и жизнеспособность.

    РЕЗУЛЬТАТЫ

    Клеточно-специфические эффекты IMD на ответы хозяина на бактериальную инфекцию

    Активация IMD требует протеолитического удаления N-концевых тридцати аминокислот из белка Imd каспазой Dredd и экспрессии нерасщепляемого Imd ( ImdD30A) предотвращает передачу сигнала по пути IMD (36). Таким образом, экспрессия ImdD30A в жировом теле взрослого человека блокирует инфекционно-зависимую экспрессию IMD-чувствительного антимикробного пептида диптерицина (рис.S1A). Чтобы определить, как клеточно-специфическая инактивация IMD влияет на выживаемость после орального заражения V.cholerae , мы использовали систему экспрессии гена TARGET (37) для экспрессии ImdD30A исключительно в кишечных предшественниках ( esg ts / D30A ), или в дифференцированных энтероцитах ( Myo1A ts / D30A ). Мы выбрали V. cholerae для этих исследований, поскольку предыдущая работа показала, что активность IMD вносит вклад в V.cholerae- зависимая смертность (38). Когда мы заблокировали IMD у предшественников, мы обнаружили, что мухи, инфицированные V. cholerae , умирали значительно быстрее, чем контрольные esg ts / + мух (рис. S1B). Напротив, энтероцит-специфическое подавление IMD увеличивало выживаемость инфицированных мух по сравнению с контрольными Myo1A ts / + (рис. S1C). Примечательно, что мы обнаружили равные количества V. cholerae в esg ts / D30A мух и Myo1A ts / D30A мух по сравнению с соответствующими контрольными мухами.S1D и E). Мы также изучили влияние esg ts / D30A и Myo1A ts / D30A на скорость кормления, возможный модификатор колонизации хозяина 336 холерой V. В этих экспериментах мы обнаружили, что esg ts / D30A мух и Myo1A ts / D30A мух потребляли равное количество жидкости (рис.S1F и G) или твердая (рис. S1H и I) пища в качестве их соответствующих контролей, что позволяет предположить, что IMD оказывает клеточно-специфическое влияние на толерантность хозяина к кишечному патогену.

    Эффекты клеточно-специфической инактивации IMD на микробиом кишечника

    Учитывая различное влияние активности IMD энтероцитов и предшественников на выживаемость хозяина патогенных бактерий, мы спросили, модифицирует ли IMD также взаимодействия с симбиотическими бактериями клеточно-специфическим образом. Чтобы ответить на этот вопрос, мы сгенерировали аксенические популяции esg ts / +, esg ts / D30A, Myo1A ts

  • 5/

    3 +
    ts / D30A эмбрионов (рис.1А). Мы выращивали эмбрионы при 21 ° C в стерильной среде до зрелого возраста, чтобы предотвратить нежелательную экспрессию imdD30A во время развития. Мы одновременно скармливали всем взрослым особям аксеника гомогенат, приготовленный из наших лабораторных мух дикого типа, чтобы гарантировать, что все генотипы имеют идентичные исходные микробиомы. Затем мы перенесли мух в температуру 29 ° C, чтобы вызвать экспрессию ImdD30A в предшественниках ( esg ts / D30A ) или энтероцитах ( Myo1A ts / D30S, и провели трипликат ). анализы с глубоким секвенированием кишечного микробиома каждого генотипа на пятый и двадцатый дни.Из 24 образцов 22 имели достаточную глубину считывания, чтобы мы могли определить общий состав бактериального микробиома кишечника. Анализ основных компонентов (рис. 1B), показатели филогенетического разнообразия (рис. 1C) и анализ операционных таксономических единиц (OTU) (рис. 1D) позволяют предположить, что инактивация IMD в энтероцитах оказала минимальное влияние на состав или разнообразие кишечника. микробиом в оба момента времени. Напротив, инактивация IMD у предшественников, по-видимому, влияет на разнообразие (рис.1C) и относительный состав OTU кишечного микробиома (рисунок 1D), особенно на ранних стадиях. Здесь мы отметили увеличение представительства Lactobacillus OTU в пятидневных esg ts / D30A кишечнике по сравнению с esg ts контрольной группы. . В более старом кишечнике мы наблюдали обратный эффект (рис. 1D). В этом случае относительная численность Lactobacillus OTU была ниже в популяциях esg ts > D30A (средняя численность: 8.1%), чем у всех остальных генотипов (средняя численность: 15,2%). Затем мы сгенерировали деревья баланса (39), чтобы определить, влияет ли ограниченная клетками инактивация IMD на численность бактериальных подсообществ в микробиоме. Эти исследования выявили доминирующий баланс, обогащенный Lactobacillales и Psudomonadales , который отличал кишечник пятидневного возраста esg ts / D30A от всех других генотипов (рис. 1E и F). В совокупности эти данные предполагают клеточно-зависимый вклад IMD в ассоциации хозяина с видами Lactobacillus : ингибирование IMD в клетках-предшественниках специфически влияет на изобилие Lactobacillus OTU, в то время как ингибирование IMD в энтероцитах, по-видимому, имеет незначительный эффект.

    РИСУНОК 1.

    A: Образование взрослых мух с аналогичными популяциями симбиотических бактерий. B: Анализ основных компонентов бактериальных OTU, идентифицированных у мух указанных генотипов и возрастов. C: Верность измерениям филогенетического разнообразия бактериальных OTU у мух указанных генотипов и возрастов. Буквы над каждым генотипом обозначают группы, которые значительно отличаются друг от друга. D: Графическая иллюстрация повторной количественной оценки OTU у мух указанного возраста и генотипа.E: Тепловая карта относительной численности бактериальных OTU у мух указанного возраста и генотипа. F: Анализ Гнейса использовался для определения баланса бактерий, который различается между группами лечения. G: Изобилие рода бактерий в наиболее четко выраженном бактериальном балансе.

    Потеря IMD у предшественников влияет на ассоциацию с симбиотическими

    Lactobacillus разновидностями

    Поскольку IMD оказывает клеточно-специфическое влияние на представление кишечных OTU, мы спросили, влияет ли инактивация IMD, специфичная для предшественников или энтероцитов, также на общее количество кишечных бактерий.Для этого эксперимента мы стандартизировали бактериальный состав, связанный с каждой линией мух. В частности, мы создали аксенические эмбрионы всех генотипов для устранения эндогенного микробиома и полиассоциированные аксенические взрослые особи со смесью 1: 1: 1 трех симбионтов обыкновенных мух — Acetobacter pasteurianus ( Ap ), Lactobacillus brevis ( Lb ) и Lactobacillus plantarum ( Lp ). Чтобы отследить возрастные изменения микробиоты мух с нарушенной иммунной защитой кишечника, мы измерили бактериальную нагрузку у взрослых мух, которых мы выращивали при 29 ° C в течение 1, 10, 20 или 30 дней.В соответствии с нашими данными глубокого секвенирования, специфическое для энтероцитов подавление IMD не влияло на нагрузку каких-либо тестируемых видов бактерий в любой момент времени (рис. S2A). Точно так же мы не наблюдали измеримых эффектов ингибирования IMD у предшественников при нагрузках Ap во все время тестирования (рис. S2B). Напротив, мы обнаружили возрастные эффекты ингибирования IMD у предшественников на количество Lactobacillus в кишечнике. В частности, мы обнаружили значительное снижение количества колониеобразующих единиц на муху как у Lb , так и у Lp в esg ts / D30A мух через 30 дней по сравнению с мухами соответствующего возраста esg ts / + элементы управления (рис.S3B). В сочетании с данными на рисунке 1, наши результаты предполагают, что активность IMD в клетках-предшественниках способствует ассоциации хозяина с симбионтами Lactobacillus с возрастом мух.

    IMD энтероцитов регулирует метаболизм и жизнеспособность взрослых

    Учитывая специфические для клеток эффекты IMD на вирулентность патогенов, разнообразие микробиома и нагрузку на симбионтов, мы предположили, что путь IMD также будет оказывать клеточно-специфический контроль транскрипционных событий в средней кишке. Чтобы проверить эту гипотезу, мы провели параллельный анализ секвенирования РНК транскриптомов средней кишки, в котором мы специально инактивировали IMD в энтероцитах или в предшественниках.Мы подтвердили, что экспрессия ImdD30A в энтероцитах ингибирует экспрессию репортерного гена диптерицина в энтероцитах, тогда как экспрессия ImdD30A в предшественниках не нарушает экспрессию диптерицина в дифференцированном потомстве, подтверждая полезность этого подхода для блокирования IMD в целевых ячеек (Таблица S1). Затем мы исследовали транскриптомы очищенной средней кишки из Myo1A ts / D30A и контрольного Myo1A ts / + мух, которых мы выращивали при 29 ° C в течение десяти дней (10 дней).2А). Ингибирование IMD в энтероцитах оказало существенное влияние на транскрипционную активность кишечника (фиг. 2B, C), в том числе на когорту иммунных эффекторов и модуляторов (фиг. S3A). Мы также обнаружили, что ингибирование IMD в энтероцитах оказывает значительное влияние на такие разнообразные процессы, как контроль формы клеток, транспорт метаболитов и метаболизм аминокислот (рис. 2D). Широкое влияние на экспрессию метаболических регуляторов побудило нас задаться вопросом, влияет ли ингибирование IMD в энтероцитах на метаболизм у мух.Чтобы ответить на этот вопрос, мы исследовали уровни глюкозы, трегалозы и липидов в кишечнике и тушах Myo1A ts / D30A и Myo1A ts / + ts / + ° C в течение десяти дней. Ингибирование IMD энтероцитов не влияло на уровни глюкозы у всей мухи или в кишечнике (рис. 2E и F). Точно так же ингибирование IMD в энтероцитах не повлияло на трегалозу, основной циркулирующий дисахарид у мух (рис.2G). Напротив, ингибирование IMD в энтероцитах вызвало значительное увеличение общего (фиг. 2H) и кишечного уровней триглицеридов (фиг. 2I), а также увеличение веса взрослого человека (фиг. 2J). Интересно, что мутация потери функции в imd снижает уровни триглицеридов (рис. S3B), указывая на энтероцит-специфические роли IMD в хранении триглицеридов. Поскольку IMD энтероцитов изменяет ключевые процессы, такие как метаболизм в кишечнике, мы пришли к выводу, что инактивация IMD будет иметь последствия для физиологии кишечника и жизнеспособности животных.В соответствии с этим предсказанием мы обнаружили, что блокирование IMD в энтероцитах нарушает пролиферацию кишечных стволовых клеток (рис. 2K) и сокращает продолжительность жизни взрослого человека (рис. 2L). В совокупности эти результаты показывают, что активность IMD энтероцитов способствует регуляции метаболизма и жизнеспособности взрослых.

    РИСУНОК 2.

    A: Экспериментальная стратегия транскриптомного анализа вскрытой средней кишки мух с модифицированной активностью IMD. B: Анализ основных компонентов данных экспрессии генов для контрольных мух ( Myo1A ts / + ) и мух с блокированной активностью IMD в энтероцитах ( Myo1A ts / D30A ).C: Вулканический график генов, которые дифференциально экспрессируются в Myo1A ts / D30A средней кишки относительно Myo1A ts / + средней кишки. Каждая точка представляет один ген. Оранжевый указывает на гены с более чем 2-кратным изменением экспрессии генов. Зеленым цветом обозначены гены с более чем 2-кратным изменением экспрессии генов и FDR ниже 0,01. D: Термин «генная онтология» — анализ путей, модифицированных ингибированием IMD в энтероцитах.Размер столбца указывает кратное обогащение, а кружки показывают значимость этого обогащения в отрицательной логарифмической шкале. E-J: Количественное определение глюкозы (E-F), трегалозы (G), триглицеридов (H, I) и веса (J) целых мух или вскрытой средней кишки мух указанных генотипов. Значения P получены из тестов значимости, выполненных с помощью t-критерия Стьюдента для каждого измерения. K: Количественное определение фосфогистон h4-положительных митотических клеток в задней части средней кишки мух указанных генотипов, выращенных при 29 ° C в течение 28 дней.L: Кривые выживаемости контрольных мух (-) или мух с активностью IMD, заблокированной в энтероцитах (+). N = количество мух для каждого генотипа. Значения хи-квадрат и P взяты из тестов логарифмического ранга.

    Специфические для предшественников роли для IMD

    Параллельно с характеристикой транскрипции Myo1A ts / D30A средней кишки, мы определили транскриптомы очищенной средней кишки из esg

    tsg 9 tsg и esg ts / + мух, которых мы выращивали при 29 ° C в течение десяти дней.Опять же, мы заметили значительное влияние ингибирования IMD на транскрипционную активность в средней кишке (рис. 3A и B). Исследование терминов GO, на которые влияет ингибирование IMD в предшественниках, выявило частичное перекрытие с терминами GO, на которые влияет ингибирование IMD в энтероцитах, включая гены, связанные с метаболизмом аминокислот или глутатиона (рис. 3C). Однако ингибирование IMD у предшественников имело уникальные характеристики, которые отсутствовали в транскриптоме мух с ингибированием IMD энтероцитов. Например, ингибирование IMD в предшественниках увеличивает экспрессию генов, участвующих в катаболизме липидов, и снижает экспрессию генов, участвующих в РНК-интерференции (рис.3С). Фактически, более 30% всех генов, на которые воздействует ингибирование IMD в предшественниках, не были затронуты ингибированием IMD в энтероцитах (рис. 3D и E), что указывает на уникальную роль активности IMD клеток-предшественников в кишечнике. Тщательное изучение генов, дифференциально затрагиваемых ингибированием IMD у предшественников, выявило существенное влияние на гены иммунного ответа (Fig. 3F). Мы также заметили влияние на экспрессию генов, необходимых для биогенеза piRNA; абсорбция холестерина и передача сигналов; пути Notch, Wnt и JAK / STAT; протеостаз; и регулирование продолжительности жизни взрослого человека (рис.3F). Мы считаем эти изменения экспрессии генов особенно интересными, так как многие из этих путей участвуют в гомеостазе клеток-предшественников и старении (40–42). Итак, наши исследования транскрипции показывают большие различия между вкладом IMD энтероцитов или клеток-предшественников в гомеостаз кишечника и повышают вероятность того, что IMD клеток-предшественников играет уникальную роль в регуляции функции стволовых клеток кишечника.

    РИСУНОК 3.

    A: Анализ основных компонентов данных экспрессии генов для контрольных мух ( esg ts / + ) и мух с IMD-активностью, заблокированной в клетках-предшественниках ( esg ts / D30A ).B: Вулканический график генов, которые дифференциально экспрессируются в esg ts / D30A средней кишки относительно esg ts / + средней кишки. Каждая точка представляет один ген. Оранжевый указывает на гены с более чем 2-кратным изменением экспрессии генов. Зеленым цветом обозначены гены с более чем 2-кратным изменением экспрессии генов и FDR ниже 0,01. C: Термин «генная онтология» — анализ путей, модифицированных ингибированием IMD у предшественников.Размер столбца указывает кратное обогащение, а кружки показывают значимость этого обогащения в отрицательной логарифмической шкале. D: Диаграммы Венна перекрытия между генами, которые активируются или подавляются в esg ts / D30A и Myo1A ts / D30A , как указано. F: Таблица, показывающая гены, участвующие в иммунитете; биогенез пиРНК; абсорбция холестерина и передача сигналов; сигнальная трансдукция; протеостаз; и долговечность, которые дифференцированно регулируются в esg ts / D30A midguts по сравнению с esg ts / + midguts.Положительные баллы указывают на гены, которые активированы в esg ts / D30A средней кишки, а отрицательные баллы указывают на подавляющую регуляцию генов. Все числовые значения указывают кратное изменение по логарифмической шкале 2 .

    Инактивация IMD в предшественниках нарушает гомеостаз кишечника

    Чтобы определить, как ингибирование IMD в предшественниках влияет на эпителий кишечника, мы подготовили профиль секвенирования одноклеточной РНК для 1509 клеток, которые мы выделили из кишечника esg ts / + мух и 1779 клеток, которые мы очистили из esg ts / D30A кишечника (рис.4А). Глядя на контроль, esg ts / + мух, мы легко идентифицировали популяции клеток-предшественников, эндокринных клеток и энтероцитов (рис. 4B), которые экспрессируют маркеры роста и дифференцировки (предшественники), желудочно-кишечные пептиды (эндокринные клетки). и метаболические ферменты (энтероциты) (рис. 4D). Исследование паттернов экспрессии генов в клетках, полученных из esg ts / D30A кишечника, показало, что экспрессия ImdD30A в клетках-предшественниках оказывает существенное влияние на гомеостаз эпителия (рис.4С). Например, мы обнаружили новую популяцию клеток, которые экспрессируют маркеры клеток-предшественников, такие как Notch и headcase, но не экспрессируют esg . Мы предварительно назвали эти клетки hdc +, esg — (рис. 4C, E) и отметили, что они также не могут экспрессировать элементы пути EGF и JAK / STAT, критические для роста предшественников, предполагая, что это недифференцированный, непролиферативный тип клеток (рис. S4). Глядя на дифференцированные клетки, мы наблюдали появление четвертой популяции задних энтероцитов и умеренное снижение эндокринного числа с 10% всех клеток в esg ts / + кишечника до 7% всех клеток. в esg ts / D30A кишечнике.Поразительно, что изменения в эндокринных клетках включали полное отсутствие популяции EE1 (Fig. 4E), указывая тем самым, что IMD необходим в предшественниках для развития секреторного клеточного клона.

    РИСУНОК 4.

    A: Стратегия получения атласов экспрессии одноклеточной РНК для средней кишки взрослой мухи. B-C: графики tSNE кластеров клеточного типа в кишечнике мух esg ts / + (B) и esg ts / D30A (C).EC = энтероцит, EE = энтероэндокринная клетка. D-E: Пузырьковый график экспрессии маркерного гена в указанных клетках для мух esg ts / + (D) и esg ts / D30A (E). Размер пузырька = процент ячеек, экспрессирующих маркер. Тепловая карта показывает степень выраженности.

    Когда мы исследовали термины онтологии генов, на которые влияет ингибирование IMD у предшественников, мы заметили значительные эффекты на экспрессию генов, необходимых для роста и гомеостаза в компартменте предшественников; для межклеточного контакта и транспорта везикул в эндокринных клетках; и для метаболических процессов или транспорта в энтероцитах (рис. 5А).Более тщательное изучение дифференциально экспрессируемых генов подтвердило, что ингибирование IMD значительно влияет на экспрессию генов, которые способствуют адгезии и дифференцировке клеток-предшественников в кишечной нише (рис. 5B). В эндокринных клетках мы наблюдали полную потерю экспрессии некоторых пептидных гормонов, таких как аллатостатин A ( AstA ), а также эктопическую экспрессию генов пептида нейропептида F ( NPF ) и тахикинина ( Tk ) в популяция EE3 (рис. 5C), возможно, как компенсация потери клеток EE1.Наконец, мы обнаружили, что ингибирование IMD в клетках-предшественниках влияет на экспрессию важных пищеварительных, структурных и микробных генов в популяциях энтероцитов (рис. 5D). В совокупности данные, представленные на фигурах с третьего по пятый, указывают на участие IMD клеток-предшественников в поддержании гомеостаза кишечника.

    РИСУНОК 5.

    A: Пузырьковое представление терминов GO, дифференциально регулируемых в клетках esg ts / D30A относительно esg ts / + клеток.Размер пузырька указывает на кратное обогащение соответствующих терминов. Цвет указывает на условия повышенного или пониженного регулирования. B: Графики скрипки, показывающие экспрессию репрезентативных генов (ген Notch-response E (spl) m3-HLH ; регулятор EGF Cbl ; регулятор аутофагии Atg8a ; интегрины scb и mys , а также торговец холестерином 43356 Npc2f ), которые значительно по-разному экспрессировались в клетках-предшественниках esg ts / D30A по сравнению с esg ts / + предшественниками.C: Графики для скрипки, показывающие относительную экспрессию пяти эндокринных пептидов в esg ts / D30A и esg ts / + типах эндокринных клеток. D: Относительная экспрессия гена бактериального ответа whe , муцина Muc68D и пищеварительного фермента дельта-трипсин в энтероцитах esg ts / D30A и ts2 esg esg / + кишечник.Все три значительно по-разному экспрессируются в энтероцитах esg ts / D30A по сравнению с esg ts / + энтероцитами. Для B-D. Значения экспрессии генов являются нормализованными и логарифмически преобразованными значениями экспрессии отдельных ячеек.

    Активность IMD в предшественниках способствует пролиферации стволовых клеток и жизнеспособности

    Drosophila

    Чтобы напрямую измерить влияние ингибирования IMD в клетках-предшественниках на физиологию кишечника, мы количественно оценили количество стволовых клеток у молодых и старых мух, используя дельта в качестве маркера стволовых клеток.Мы наблюдали значительное снижение процента дельта-положительных клеток у мух esg ts / D30A по сравнению с esg ts / + контрольных мух при старении мух в течение 30 дней. (Рис. 6A). Эти результаты предполагают, что активность IMD необходима для гомеостатической пролиферации ISC у взрослых мух. В соответствии с этой гипотезой мы обнаружили значительное снижение пролиферирующих клеток у мух esg ts / D30A по сравнению с esg ts / + контрольных мух (рис.6Б).

    РИСУНОК 6.

    A: Процент клеток, положительных по маркеру стволовых клеток, дельта в задней части средней кишки мух указанных генотипов и возрастов. Значение P получено из теста значимости, выполненного с помощью t-критерия Стьюдента. B: Количественное определение фосфогистон h4-положительных митотических клеток в задней части средней кишки 28-дневных мух указанных генотипов. Значение P получено из теста значимости, выполненного с помощью t-критерия Стьюдента. C-D: Кривые выживаемости самок контрольных мух (-) или мух с заблокированной активностью IMD в предшественниках (+).N = количество мух, протестированных для каждого генотипа. Значения хи-квадрат и P являются результатами тестов логарифмического ранга. Исследования выживаемости проводились с двумя разными мухами, экспрессирующими imdD30A (обозначенными 1 и 2 соответственно).

    Учитывая влияние ингибирования IMD на обновление и дифференцировку эпителия, мы спросили, подавляет ли специфическое для предшественников ингибирование IMD жизнеспособность мух. Для этого эксперимента мы использовали RU486-индуцируемую систему GeneSwitch GAL4 (37) для блокирования IMD у предшественников. Используя две независимые линии UASimdD30A , мы отслеживали продолжительность жизни контрольных мух и мух со специфическим для предшественников подавлением IMD.В обоих случаях мы обнаружили, что мухи умирали значительно быстрее, когда IMD ​​блокировался у предшественников, по сравнению с их контролем (рис. 6 C и D). Взятые вместе, наши данные показывают, что активность IMD в компартменте-предшественнике защищает мух от патогенных Vibrio cholerae , поддерживает рост симбиотических видов Lactobacillus и способствует росту эпителия и долголетию взрослых особей.

    ОБСУЖДЕНИЕ

    Чтобы понять, как защитные механизмы кишечника поддерживают здоровье животных, важно спросить, как иммунная активность отдельных типов клеток способствует гомеостазу кишечника.Мы использовали Drosophila melanogaster , чтобы охарактеризовать вклад иммунной передачи сигналов в кишечных предшественниках или энтероцитах в гомеостаз кишечника. Наше исследование выявило клеточно-специфический вклад IMD в метаболизм хозяина, рост кишечника и выживаемость кишечной инфекции. IMD играет сложную роль в регуляции антибактериальных реакций кишечника (43). В передней части активация IMD в дифференцированных эпителиальных клетках требует обнаружения внешнего клеточного полимерного пептидогликана с помощью PGRP-LC (24).В задней части средней кишки компоненты IMD экспрессируются и активны в энтероцитах и ​​в клетках-предшественниках (27–29), где активация IMD происходит при обнаружении цитозольного мономерного пептидогликана с помощью PGRP-LE (24, 25). Здесь IMD способствует отслаиванию поврежденных эпителиальных клеток (44) и экспрессии иммуно-регуляторных молекул (45). Изменения IMD были связаны с влиянием на размер и состав микробиома кишечника (15, 17–20) и продолжительность жизни мух (46–49). У взрослых IMD также играет сложную роль в ответах на кишечные инфекции.Например, IMD необходим для выживания при заражении патогенным Serratia marcescens (50), в то время как IMD ускоряет гибель мух после заражения Vibrio cholerae (38).

    В настоящее время мы мало знаем о клеточно-специфических аспектах активности IMD в средней кишке. Например, несколько линий доказательств причастности IMD к метаболическому гомеостазу (17, 51–53). Однако мы не знаем, являются ли эти иммуно-метаболические связи клеточными или вторичными по отношению к IMD-опосредованным изменениям микробиоты кишечника с сопутствующими сдвигами в микробном контроле метаболизма в организме хозяина.Наши результаты показывают, что IMD энтероцитов регулирует метаболизм хозяина независимо от микробиома, поскольку ингибирование IMD энтероцитов не влияет на количество бактерий или состав микробиома. Модификация IMD энтероцитов также влияет на метаболизм в дистальных участках, поскольку ингибирование IMD энтероцитов вызывает увеличение веса и гиперлипидемию у взрослых. Эти наблюдения согласуются с недавним отчетом о том, что кишечные IMD влияют на иммунные реакции жирового тела (54). Мы отмечаем, что мутации в нескольких генах пути IMD также связаны с ускоренным липолизом у взрослых мух (55), что дополнительно указывает на участие пути IMD в контроле и использовании запасов липидов.

    Очевидное отсутствие сдвигов в микробиоме после ингибирования IMD энтероцитов было неожиданным, учитывая влияние мутаций пути IMD на микробиоту (15, 17–20). Возможно, что активность IMD в областях кишечника, не рассматриваемых в этом исследовании, таких как кислые медные клетки, может иметь более выраженное влияние на микробиом. Однако мы отмечаем, что недавнее исследование показало сходство между микробиомом мух, выращиваемых традиционным способом, и мух с иммунодефицитом dif ; ключевых мутантов (56).Кроме того, иммунные дефекты оказывают минимальное влияние на микробиом кишечника рыб или мышей (57, 58). В этих моделях семейная передача, по-видимому, является основным фактором, определяющим состав микробиома. Поскольку бактерии циркулируют из пищи в кишечник у Drosophila (59), мы считаем возможным, что мутации в IMD влияют на рециркуляцию симбиотических бактерий, возможно, путем изменения питания (55), с последующими последствиями для микробиома кишечника.

    В отличие от энтероцитов, ингибирование IMD у предшественников оказало заметное влияние на симбиотические Lactobacillus .Эти наблюдения соответствуют недавней характеристике мух с мутациями в PGRP-SD , модификаторе пути IMD, который экспрессируется в клетках-предшественниках задней части средней кишки (27). Потеря PGRP-SD специфически влияет на уровни Lactobacillus plantarum в кишечнике, но не влияет на уровни Acetobacter pomorum . В будущем будет интересно посмотреть, вызваны ли эффекты IMD на виды Lactobacillus кишечника изменениями иммунной толерантности видов Lactobacillus , изменениями в доступности промежуточных продуктов метаболизма, необходимых для роста бактерий, или сочетанием эти факторы.

    Мутационная инактивация ингибиторов IMD или хроническая активация IMD ускоряет рост кишечного эпителия (46, 60, 61), хотя механизм остается неясным. Наша работа устанавливает IMD как внутренний регулятор роста предшественников; ингибирование IMD в компартменте предшественников приводит к потере кишечных предшественников, снижению обновления эпителия и неправильной дифференцировке эпителия. Нас особенно поразила роль IMD клеток-предшественников в развитии энтероэндокринных клеток.Мы обнаружили, что блокирование IMD у предшественников привело к снижению общего количества эндокринных клеток, включая потерю AstA -положительной популяции EE1. Эти наблюдения имеют параллели с рыбками данио, мышами и крысами, где удаление кишечного микробиома приводит к снижению эндокринных количеств (34, 62, 63), что указывает на эволюционно законсервированную потребность в путях бактериального ответа при развитии секреторных клеточных линий. Недавние исследования вовлекают позвоночный сенсор цитозольного PGN, NOD2, в регенерацию эпителия (31, 32), подтверждая, что иммунная регуляция роста клеток-предшественников может быть эволюционно консервативным событием.Наше исследование не определяет, регулирует ли IMD клеток-предшественников обновление эпителия, контролируя жизнеспособность, пролиферацию или дифференцировку предшественников, и для решения этого вопроса необходимы будущие эксперименты.

    Наконец, клеточно-специфические функции IMD, описанные в этом исследовании, имеют последствия для способности взрослых мух выживать после кишечного патогена Vibrio cholerae. Мутанты imd выживают при инфекциях V. cholerae дольше, чем контроли дикого типа (38), что указывает на роль IMD в гибели хозяина.Ингибирование IMD энтероцитов повторяет этот фенотип, тогда как ингибирование IMD у предшественников имеет противоположный эффект. Эти данные предполагают, что IMD энтероцитов способствует V. cholerae -зависимой гибели мух, тогда как IMD клеток-предшественников противодействует эффектам инфекции. Интересно, что ни один из фенотипов не является результатом изменений в потреблении бактерий или нагрузке на кишечник V. cholerae , что позволяет предположить, что IMD напрямую влияет на способность мух переносить V.холера . Поскольку инфекции V. cholerae чувствительны к доступности метаболитов (64), а IMD ​​оказывает клеточно-специфическое влияние на метаболизм кишечника, мы рассматриваем иммуноопосредованную регуляцию метаболизма в кишечнике в качестве механизма-кандидата, с помощью которого IMD влияет на выживаемость после заражения V. холера .

    Таким образом, наши данные позволяют предположить, что IMD энтероцитов влияет на кишечный и системный метаболизм на лету. Утрата этой активности влияет на вес мух и уровень липидов, а также создает кишечную среду, благоприятную для V.cholerae патогенез. Активность IMD клеток-предшественников также влияет на экспрессию генов метаболического пути, хотя и отличается от генов, контролируемых IMD в энтероцитах, и создает кишечную среду, которая увеличивает выживаемость хозяина после заражения V. cholerae . В отсутствие инфекционного агента ингибирование IMD в клетках-предшественниках снижает рост и обновление кишечных предшественников, значительно сокращая продолжительность жизни мух. Учитывая эволюционное сохранение иммунных ответов, мы полагаем, что эти данные могут иметь значение для понимания фундаментальных принципов иммунорегулируемого гомеостаза кишечника.

    МАТЕРИАЛЫ И МЕТОДЫ

    Fly Husbandry

    Мы использовали w 1118 как штамм дикого типа. Мы скрестили трансгенных линий UAS-imdD30A на фоне w 1118 в течение восьми поколений перед использованием и использовали стандартные методы разведения мух, чтобы гарантировать, что esg ts ( esg-GAL tub-GAL80 ts , UAS-GFP ) мухи имели те же первую и третью хромосомы, что и наша линия дикого типа.Мы поддерживали все поголовье мух на стандартной среде кукурузной муки (состав Nutri-Fly Bloomington, https://bdsc.indiana.edu/information/recipes/bloomfood.html; Genesse Scientific). Все экспериментальные мухи были взрослыми девственными самками, которых содержали при цикле 12: 12 часов свет: темнота. Модель esg ts -GAL4, Myo1A ts -GAL4 ( Myo1A-GAL4 ; ванна-GAL80 43 943 9035 ts 5966 GS-GAL4 (RU-486-опосредованная экспрессия GAL4 в энтероцитах) и 5961 GS-GAL4 (RU-486-опосредованная экспрессия GAL4 в клетках-предшественниках) были описаны ранее (65–67).Конструкция pENTR / D-TOPO Imd, использованная в этом исследовании, была описана в другом месте (68). Мы генерировали ImdD30A в ходе двухэтапной реакции ПЦР с сайт-направленным мутагенезом с использованием следующих праймеров: imd-forward (CACCATGTCAAAGCTCAGGAACC), imdD30A-reverse (CCACGGGAGCTGCGGCCTTTTCCAGGCGTCCC), imdD30A-forward (GGGGACGCC), imdD30A-forward (GGGGACGCC), imdD30A-forward (GGGGACGCC) Мы секвенировали полученный клон, чтобы подтвердить точечную мутацию, и рекомбинировали его с pTW (LR-рекомбинация; Invitrogen) для создания плазмиды UASImdD30A .Трансгенные линии были созданы Bestgene Inc. (Калифорния, США). Чтобы сделать аксенических мух, мы поместили около 100 мух в клетку для разведения с пластинами агара с яблочным соком, содержащими дрожжевую пасту, на ночь. На следующее утро мы собрали яйца с чашек с агаром с яблочным соком после визуального осмотра, чтобы подтвердить отсутствие личинок, и стерилизовали их, промывая в 10% растворе 7,4% гипохлорита натрия дважды в течение 2,5 минут с последующей промывкой в ​​течение 1 минуты 70% EtOH. , и три промывки автоклавированной водой.Работая в вытяжном шкафу для культивирования тканей, мы перенесли аксенические яйца в автоклавированный стандартный корм для мух и перенесли флаконы в деконтаминированный инкубатор с температурой 21 ° C при цикле свет: темнота 12 часов: 12 часов. Чтобы подтвердить, что мухи были аксеничными, мы регулярно отбирали образцы корма путем ресуспендирования в MRS (Difco Lactobacilli MRS Agar, DB, 288210) и посева на чашки с агаром MRS, которые мы проверяли на рост бактерий через 2-3 дня при 29 °. С.

    Инфекции взрослых

    V. cholerae

    Тридцать девственных самок мух каждого генотипа выращивали на стандартном корме в течение 7 дней при 29 ° C, затем инфицировали V.cholerae C6706, как описано ранее (31). Вкратце, V. cholerae разливали на чашки с агаром с лизогенным бульоном (LB) и выращивали в течение ночи при 37 ° C. На следующее утро 30 мух каждого генотипа были равномерно распределены по трем пустым флаконам и голодны в течение 2 часов до заражения. Затем мы суспендировали ночную культуру V. cholerae в 10 мл свежего LB и разводили до OD600 0,125. Мы поместили мух во флаконы, содержащие треть ватного тампона, пропитанного 3 мл на ночь В.cholerae культура. Подсчет мертвых мух проводился каждые 8 ​​часов, не переходя на свежий корм.

    Анализ продолжительности жизни

    Для всех исследований долголетия мы использовали систему экспрессии генов GeneSwitch (GS) для подавления активности IMD. Эта система имеет то преимущество, что контрольная и экспериментальная популяции имеют идентичные генотипы. Чтобы активировать систему GS, мы добавили 100 мкл RU486 (мифепристон, M8046, Sigma), растворенного в 80% EtOH (4 мг / мл), на поверхность стандартного корма и высушили в течение ночи перед добавлением мух.Для контрольных мух мы добавляли 100 мкл 80% EtOH на поверхность стандартного корма и сушили в течение ночи перед добавлением мух. Для каждой группы лечения мы поместили тридцать мух в четыре флакона. Всех мух поддерживали при 25 ° C в течение всего эксперимента при цикле свет: темнота 12: 12 часов. Мы переводили мух на свежие продукты, содержащие либо RU486, либо транспортное средство, каждый понедельник, среду и пятницу и в это время подсчитывали мертвых мух.

    Создание полиассоциированных взрослых гнотобиотиков

    Drosophila

    Мы создали аксенических мух, как описано выше, и морили мух голодом в течение 2 часов до бактериальной полиассоциации.Для получения взрослых полиассоциированных гнотобиотических особей мы скармливали аксеновым мухам смесь трех штаммов симбиотических бактерий Drosophila ( Lactobacillus plantarum KP , Lactobacillus brevis

    3 EF

    3 EF336 AD ), которые были изолированы от наших лабораторных мух дикого типа (31). Жидкие культуры каждого бактериального штамма готовили до OD600 50 в 5% сахарозе в PBS, затем смешивали в соотношении 1: 1: 1.Мы поместили 25 аксенических мух на флакон в 5 флаконов, которые содержали четверть автоклавированной ватной пробки, пропитанной 1 мл бактериальной смеси, и скармливали мухам бактериальную смесь в течение 16 часов при 29 ° C. Затем мы выращивали мух при 29 ° C на автоклавированном стандартном корме для мух на протяжении оставшейся части эксперимента, переходя на свежий автоклавированный корм каждый понедельник, среду и пятницу. Для определения КОЕ из каждой группы собирали по 25 мух и стерилизовали поверхность путем последовательной промывки в 10% растворе 7,4% гипохлорита натрия, дистиллированной воды, 70% этанола и дистиллированной воды.Мух случайным образом делили на группы по 5 и механически гомогенизировали в 500 мкл бульона MRS. Мы серийно разводили гомогенаты в 96-луночном планшете и высевали 10 мкл пятен на агар MRS для отбора видов Lactobacillus или на агар GYC для отбора Acetobacter pasteurianus . Колонии подсчитывали после 2 дней роста при 29 ° C. Мы выделили L. plantarum и L. brevis на основе морфологии колонии: L. plantarum образует сплошные белые непрозрачные колонии, а L.brevis колонии были большими, круглыми, с неправильными краями, с не совсем белым центром и полупрозрачными краями. Для подсчета КОЕ V. cholerae мы использовали процедуру, описанную выше, работая с 7-дневными девственными взрослыми самками мух, которых мы инфицировали V. cholerae при 29 ° C в течение 24 часов перед гомогенизацией в буфере LB.

    Подготовка библиотеки для глубокого секвенирования 16S

    Для глубокого секвенирования 16S мы выращивали эмбрионы аксенической мухи на автоклавированной стандартной среде кукурузной муки при 21 ° C.Отбирали осевых девственных самок и скармливали гомогенатом мух дикого типа. Для приготовления гомогената мы гомогенизировали около 300 взрослых мух в 50 мл 5% сахарозы в PBS. Мы добавили 3 мл гомогената к трети ватного тампона (Fisher Scientific Canada 14127106) на дне чистого флакона. Мы перенесли аксенических мух в каждый флакон (25 мух / флакон) и скармливали мухам гомогенат в течение 16 часов при 29 ° C. Мух переносили на свежий автоклавированный корм и держали на автоклавированном корме в течение 5 или 29 дней при 29 ° C, еженедельно переводя на свежий корм.Поверхность мух стерилизовали, затем бактериальную ДНК экстрагировали с использованием набора для выделения микробной ДНК UltraClean (MO BIO Laboratories, Inc., Каталожный номер: 12224-250). Бактериальная ДНК 16S была амплифицирована с помощью PFX Taq (Invitrogen) с использованием праймеров 16S панбактериальной ДНК (вперед: AGAGTTTGATCCTGGCTCAG, обратная сторона: GGCTACCTTGTTACGACTT), подтверждена электрофорезом, затем очищена с помощью набора для очистки QIAquick PCR Purification Kit (QIAGEN). Мы измерили концентрацию ДНК на Qubit 2.0, затем использовали 1 нг ДНК для создания библиотеки с помощью Nextera PCR Master Mix (Illumina).Библиотеки очищали шариками AMPure ™ (QIAGEN), затем объединенные библиотеки обрабатывали на платформе Illumina MiSeq с помощью набора реагентов MiSeq Reagent Kit v3 (600 циклов).

    Анализ кормления

    Мы провели анализ капиллярного питателя (CAFE), как описано ранее (69). Вкратце, мы выращивали девственных самок соответствующих генотипов при 29 ° C в течение 7 дней. Мы поместили десять мух на флакон во флаконы с тремя капиллярами (калиброванные пипетки (5 мкл, VWR, каталожный номер 53432-706)), которые содержали жидкий корм с 8 капиллярами.1% сахарозы (D-сахароза, Fisher BioReagents, BP220-212) и 1,9% дрожжевого экстракта (BD, 212750). Мы измерили потребление по десяти флаконам для каждого генотипа. В то же время у нас был контрольный флакон, содержащий три капилляра с пищей, но без мух. Чтобы количественно оценить потребление пищи на одну муху, мы рассчитали (еда, потребляемая в пробирках с мухами — еда, потребляемая в контрольной пробирке без мух) / количество мух на муху. Для FlyPad девственные взрослые особи женского пола выдерживались в течение 23-24 дней при 29 ° C (25 мух на флакон) с еженедельным обновлением пищи.Перед анализом мух голодали на 1% (мас. / Об.) Агаре в течение 4 часов при 29 ° C. Мух помещали на арены (одна муха на арену) с 3 мкл корма, содержащего 8,1% сахарозы, 1,9% дрожжевого экстракта и 1% агара. За поведением при кормлении наблюдали в течение 1 часа, как описано ранее (70).

    Метаболический анализ

    Для метаболических измерений взрослых девственных самок выращивали на стандартной среде в течение 10 дней при 29 ° C. Мы измерили общий вес пяти взрослых мух, затем механически гомогенизировали в буфере ТЕ (10 мМ Трис, pH 7.4, 1 мМ EDTA pH 8,0, 0,1% Triton X-100). Гомогенаты использовали для измерения общего количества триглицеридов с помощью набора для определения уровня ТГ в сыворотке (TR0100; Sigma) и общего содержания глюкозы с помощью набора для анализа глюкозы GAGO (GAGO20; Sigma) в соответствии с инструкциями производителя. Мы выполнили те же анализы с 9-10 рассеченными кишечниками взрослых девственных самок. Для измерения циркулирующей трегалозы 20 взрослых мух на образец прокалывали в грудной клетке и центрифугировали при 9000 rcf в течение 5 минут при 4 ° C через фильтровальную трубку (Zymo Research, C1006-50-F).Гемолимфу смешивали с трегалазным буфером (5 мМ Трис, pH 6,6, 137 мМ NaCl, 2,7 мМ KCl) при разведении 1: 100 и нагревали при 70 ° C в течение 5 мин. Мы разделили смеси на две группы, одна из которых получала треалазу из свиной почки (T8778-1UN; Sigma), а другая — нет. Обе группы инкубировали при 37 ° C в течение 22 часов и обрабатывали реагентом для анализа глюкозы (GAGO20; Sigma) в течение 30 минут при 37 ° C. Чтобы остановить реакцию, мы добавили 12 н. Серную кислоту и измерили оптическую плотность при 540 нм.

    Иммунофлуоресценция

    Мы использовали ранее описанные протоколы иммунофлуоресценции для визуализации задней части средней кишки (56).Вкратце, мы использовали иммунофлуоресценцию против фосфогистона h4 (Ph4, 1: 1000, Millipore (Upstate), 06-570) для количественной оценки митозов в средней кишке и анти-дельта (1: 100; Developmental Studies Hybridoma Bank C594. 9B) иммунофлуоресценция для количественной оценки стволовых клеток в области R4 / R5 задней средней кишки девственных самок мух, выращенных нами при 29 ° C в течение 5 или 30 дней. Для окрашивания ДНК мы использовали Hoechst 33258 (1: 500; Molecular Probes) и подходящими вторичными антителами были козьи антимышиные Alexa Fluor 647 (1: 500, Invitrogen) и 568 (1: 500, Invitrogen) и козьи антикроличьи антитела Alexa. Fluor 488 (1: 1000, Invitrogen) и 546 (1: 1300, Invitrogen).Кишки помещали на предметные стекла в Fluoromount (Sigma-Aldrich F4680), а заднюю часть средней кишки визуализировали с помощью конфокального микроскопа с вращающимся диском (Quorum WaveFX; Quorum Technologies Inc.). Изображения были собраны в виде z-срезов и обработаны с помощью программного обеспечения Fiji для создания одного z-образного изображения.

    Bioinformatics

    Статистический анализ метаболических анализов, исследований долголетия и анализа выживаемости проводился с помощью GraphPad Prism. Данные о выживаемости и данные о продолжительности жизни были проанализированы с помощью тестов лог-ранга (Мантала-Кокса).Анализы питания, КОЕ, количественное определение PH-3 или дельта-положительных клеток и метаболические анализы анализировали с помощью непарных t-критериев Стьюдента. Кривые выживаемости и долговечности были созданы с помощью GraphPad Prism, а для остальных фигур использовался язык программирования R. Все фигурки собраны с помощью Adobe Illustrator. Мы использовали QIIME2-2019.1 для всего анализа данных 16S, фильтрации всех последовательностей, которые присутствовали ниже минимальной частоты 200, и использования пакета DADA2 для контроля качества последовательностей.Мы объединили последовательности на 99% идентичности и использовали базу данных greengenes для определения действующих таксономических единиц. Дифференциальный анализ численности был выполнен с использованием плагина gneiss для QIIME2. RNAseq выполняли с помощью РНК, очищенной с помощью очистки TRIZOL (ambion, 15596-026) из средней кишки взрослых мух, выращенных нами при 29 ° C в течение 10 дней. Очищенную РНК отправляли на сухом льду в Новоген (Калифорния, США) для создания библиотеки и секвенирования с помощью Illumina Platform PE150. Для исследований RNAseq мы получили примерно 40 миллионов считываний на биологическую репликацию.Мы использовали FASTQC для оценки качества необработанных считываний, парных считываний и обрезанных адаптеров, а также считываний длиной менее 36 пар оснований из исходных считываний с использованием Trimmomatic версии 0.36. Мы использовали HISAT2 версии 2.1.0 для согласования операций чтения с Drosophila transcriptome-bdgp6 и преобразовали полученные файлы BAM в файлы SAM с помощью Samtools версии 1.8. Мы подсчитали преобразованные файлы с помощью Rsubread версии 1.24.2 и загрузили их в EdgeR. В EdgeR мы отфильтровали гены с количеством меньше 1 на миллион и нормализовали библиотеки по размеру.Нормализованные библиотеки использовали для вызова генов, которые по-разному экспрессировались в разных вариантах лечения. Гены с P-значением <0,01 и FDR <0,01 были определены как дифференциально экспрессируемые. Анализ основных компонентов был выполнен на нормализованных библиотеках с использованием Factoextra версии 1.0.5, а инструмент для анализа и визуализации онтологии генов (GORILLA) был использован для определения обогащения терминов онтологии генов (GO). В частности, дифференциально экспрессируемые гены сравнивали в сравнении с двумя списками без отслеживания со всеми генами, выведенными из edgeR в качестве фонового набора, и лишние термины GO были удалены.Для анализа отдельных клеток использовали Cell Ranger v3.0 для сопоставления считываний секвенирования с эталонным транскриптомом Drosophila (FlyBase, r6.30) и создания матриц штрих-кодов признаков. Эти матрицы были проанализированы с помощью пакета Seurat R (версия 3.1.1). Клетки, содержащие <500 UMI или> 2500 UMI, были удалены, чтобы уменьшить количество низкокачественных клеток и дублетов. Затем Сера был использован для нормализации значений экспрессии и выполнения кластеризации клеток с разрешением 0,8 с 7 основными компонентами.Кластеры были идентифицированы на основе известных маркеров и предыдущего одноклеточного анализа кишечника Drosophila (https://www.flyrnai.org/scRNA/). Для анализа данных по одной клетке с помощью термина GO использовали Seurat для интеграции наборов данных esg / + и esg / D30A и создания списков дифференциально экспрессируемых генов для каждого кластера. Списки генов с повышенной и пониженной регуляцией (пороговое значение p <0,05) были проанализированы в GOrilla для определения обогащения по термину GO. Различно экспрессируемые гены сравнивали в нерейтинговом сравнении с двумя списками со всеми генами, идентифицированными в одноклеточном наборе данных.Затем термины GO были проанализированы в REVIGO (REduce и VIsualize Gene Ontology) для удаления повторяющихся терминов GO. Для каждого кластера показаны наиболее обогащенные термины GO, а также те же самые термины GO, которые можно найти в других кластерах.

    Доступность данных

    Данные по экспрессии генов были отправлены в базу данных NCBI GEO (GEO: GSE135154).

    ДОПОЛНИТЕЛЬНЫЙ МАТЕРИАЛ

    Инфекции взрослых с

    Ecc15

    Для экспериментов с септическими инфекциями мы выращивали ночную культуру Ecc15 в LB при 29 ° C при встряхивании.Мы осаждали ночную культуру в 1,5 мл микроцентрифужных пробирках и держали ее на льду. Анестезированных самок мух кололи под крылом иглой, погруженной в бактериальный осадок, контрольных мух кололи иглой, погруженной в LB. Зараженных мух переносили на ночь во флаконы, содержащие обычный корм. Количественные измерения ПЦР (кПЦР) проводили с РНК, очищенной ТРИЗОЛ от целых мух (10 на повтор), и мы использовали метод порогового значения ΔΔ цикла для расчета значений относительной экспрессии.Экспрессия генов была нормализована по актину. В этом исследовании были использованы следующие праймеры: диптерицин (F: ACCGCAGTACCCACTCAATC, R: ACTTTCCAGCTCGGTTCTGA) и актин (F: TGCCTCATCGCCGACATAA, R: 59-CACGTCACCAGGGCGTAAT).

    РИСУНОК S1.

    A: измерение qPCR экспрессии dpt у неинфицированных (имитация) или Ecc15 -инфицированных ( Ecc15 ) взрослых контрольных мух ( R4 / + ) или мух, экспрессирующих imdD30A в жире. кузов ( R4 / D30A ).Эксперименты по заражению проводили с двумя отдельными трансгенными мухами, экспрессирующими imdD30A (обозначенными 1 и 2 соответственно). B-C: Кривые выживаемости неинфицированных (ложных) или инфицированных V. cholerae (C6706) взрослых мух указанных генотипов. N = количество мух в каждой экспериментальной группе. Значения хи-квадрат и P являются результатами тестов логарифмического ранга. D-E: КОЕ / муха V. cholerae у взрослых мух указанных генотипов через 24 часа после заражения штаммом C6706 V.холера . F-G: Нормы потребления корма на взрослых мух указанных генотипов, измеренные в тесте CAFÉ в течение указанного периода дней. (H-I) Количественная оценка общего количества глотков при кормлении взрослых мух указанных генотипов. Все мухи были выращены при 29 ° C в течение 23 дней до анализа, и каждая точка представляет результаты для одной мухи. P-значения показывают результаты непарных t-критериев Стьюдента.

    РИСУНОК S2.

    A: Схематическое изображение экспериментальной стратегии создания гнотобиотических мух.БК: Количественная оценка уровней Acetobacter pateurianus ( Ap ), Lactobacillus brevis ( Lb ) и Lactobacillus plantarum ( Lp ) в кишечнике мух указанных генотипов при 29 ° C для повышенных указанная продолжительность.

    РИСУНОК S3:

    Количественная оценка относительных изменений экспрессии иммунного гена для Myo1A ts / D30A мух относительно Myo1A ts / + мух.Все измерения были взяты из данных RNAseq, показанных на рисунке 2, и показывают среднее изменение по логарифмической 2 -кратной шкале для трех биологических повторов, а также значения P и FDR для каждого гена. Количественная оценка общих уровней триглицеридов у мух указанного генотипа, выращенных на холидной диете в течение 20 дней.

    РИСУНОК S4.

    Графики для скрипки, показывающие экспрессию активирующего рецептора JAK / STAT купол , гомолога EGF Drosophila , spi и фактора транскрипции pnt пути EGF дрозофилы .




  • Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *